BIOLOGY AND MANAGEMENT OF HOP LATENT VIROID, AN EMERGING PATHOGEN OF HEMP

• Sponsoring Institution: National Institute of Food and Agriculture
• Project Status: ACTIVE
• Funding Source: AFRI COMPETITIVE GRANT
• Reporting Frequency: Annual
• Accession No.: 1032473
• Grant No.: 2024-68008-42652
• Cumulative Award Amt.: $300,000.00
• Proposal No.: 2023-09574
• Project Start Date: Jul 1, 2024
• Project End Date: Jun 30, 2026
• Grant Year: 2024
• Program Code: [A1701]- Critical Agricultural Research and Extension: CARE

Recipient Organization
COLORADO STATE UNIVERSITY
(N/A)
FORT COLLINS,CO 80523

Performing Department
(N/A)

Non Technical Summary
Hop latent viroid (HLVd) is an emerging pathogen affecting hemp with potential to cause significant damage and crop loss. Since its initial detection in California in 2019, HLVd has been detected in all major hemp growing states including Colorado, Oregon, Washington and in Canada. Through this grant proposal, PDs at Colorado State University and collaborator at Simon Fraser University in Canada will engage internationally to develop and apply new knowledge and practices regarding HLVd to mitigate disease impact.The goals of this CARE proposal will be accomplished by three objectives:1. Determine modes of HLVd transmission by arthropod vectors, pollen, and seed.2. Determine the effect of induced chemical resistance in reducing HLVd symptom development and infection levels.3. Develop effective methods to provide research-based information to hemp growers and other stakeholders.These objectives will be addressed through laboratory and greenhouse experiments in Colorado, whereas the international collaborator will submit a separate grant application to Natural Sciences and Engineering Research Council of Canada to investigate related aspects of HLVd biology and management in addition to the current proposal. The research we propose addresses priority area, A) Plant health and production and plant products" which highlights break-through discoveries and the translation of these into plant production and protection practices. An integrative (research and extension) approach will train the next generation of scientists and new tools will be made readily available to stakeholders and put into practice.

Animal Health Component

50%

Research Effort Categories

Basic

50%

Applied

50%

Developmental

0%

Classification

Knowledge Area (KA)	Subject of Investigation (SOI)	Field of Science (FOS)	Percent
212	1730	1130	100%

Knowledge Area
212 - Pathogens and Nematodes Affecting Plants;

Subject Of Investigation
1730 - Hemp;

Field Of Science
1130 - Entomology and acarology;

Keywords

hemp

chemical elicitors

hop latent viroid

insect vectors

seed and pollen transmission

Goals / Objectives
The long-term goal of thismulti-disciplinary research collaboration is to develop and apply new knowledge and practices regarding Hop latent viroid (HLVd), in an effort to manage and reduce losses to the hemp and cannabis/ marijuana industry in the U.S and worldwide.The specific objectives of this NIFA-CARE project are to:Determine modes of HLVd transmission by insect vectors, pollen, and seed.Determine the effect of induced chemical resistance in reducing HLVd symptom development and infection levels.Develop effective methods to provide research-based information to hemp growers and other stakeholders.

Project Methods
1. Determine mode of HLVd transmission by insect vectors, pollen, and seed. Methods/Techniques.HLVd inoculum and insect source. PD Nachappa's lab has a source of HLVd-infected plants (certified High-CBD cultivar, Duchess; Charlotte's Web, Fort Collins, CO) that is maintained by mechanically inoculating infected tissue onto healthy plants where hemp leaf tissues and stem infected with HLVd is ground in a mortar and pestle and the homogenate is inoculated into stem of healthy hemp plants. Various tissues including roots and leaves are tested after 2-4 weeks of inoculation to confirm presence of the viroid using RT-PCR analysis (described in detail below).HLVd transmission by hemp insects. The ability of insects to transmit HLVd will be tested in a reach-in growth chamber (8 ft2 growth area, Conviron, Canada) housed in our laboratory. Cohorts of 10 adult (2-3 days post-eclosion) aphids and thrips and larvae (2-3 stage) of corn earworm will be exposed to 3-week-old HLVd-infected hemp plants that were previously confirmed to be positive using RT-PCR. Insects will be given a 5-min acquisition access period because previous research found highest viroid acquisition at 5 min (See Recently completed activities). After the 5 min of acquisition, individuals will be collected and caged onto 3-week-old healthy hemp plants in clip cages (Bioquip, CA). The insects will be given a 48-hour inoculation access period as previously shown with viroid transmission (Antignus et al. 2007; Walia et al. 2015). After 48 hours of transmission, the leaf will be excised, and plants will be tested in two-week intervals. Tissues will be harvested from the roots and new growth for viroid detection because previous research showed that HLVd travels to the root and then through the plant (Punja, unpublished). The experiment will be repeated 25 times for each insect species.HLVd pollen and seed transmission.Experiments to determine potential for pollen and seed transmission will be performed in insect-proof cages in the greenhouse at CSU Plant Growth Facility. The high-CBD cultivar (Duchess) will be infected with HLVd as mentioned above and will be grown to maturity. Pollen will be harvested from male plants and seeds will be harvested from female plants and stored at 4°C. Pollen and seeds will also be harvested from healthy plants. Seed dissections will be performed to separate the seed coat from the testa/endosperm and embryo and tested for the presence of HLVd by RT-PCR to determine if HLVd is associated with the seed. Seed transmission rates will be determined by planting 100 seeds from infected plants. Seeds will be planted in 96-well polystyrene trays with rockwool blocks as a substrate in confined insect proof cages. Root and leaf tissue samples will be harvested at the first-leaf or true-leaf stage and analyzed for HLVd using RT-PCR. Pollen samples will be tested using RT-PCR analysis described below. Sequence analysis will be performed by direct sequencing of PCR products and sequences will be deposited in GenBank.RNA extraction and RT-PCR analysis. Total RNA will be extracted using Plant RNeasy kit (Qiagen, CA) following standard manufacturer's protocol. The RNA will be converted to cDNA using the Verso cDNA kit (Thermo FisherScientific, MA) per the standard manufacturer's protocol. The presence of HLVd will be confirmed with PCR analysis using primer set HLVd_F (CCACCGGGTAGTTTCCAACT) and HLVd_R (ATACAACTCTTGAGCGCCGA) as described in Matoušek and Patzak 2000. A sub-set of PCR amplicons from each experiment will be subjected to Sanger sequenced to confirm identity.2. Determine the effect of induced chemical resistance in reducing HLVd symptom development and infection levels.Methods/Techniques.Greenhouse experiment design. The experiments will be conducted in the greenhouse at the Plant Growth Research Facility at Colorado State University (CSU). The experimental design will be RCBD with 9 plant defense elicitors: 1) salicylic acid (SA), 2) jasmonic acid (JA), 3) abscisic acid (ABA), 4) indole-3-butric acid (IBA), 5) indole-3-acetic acid (IAA), 6) cytokinin, 7) chitosan, a naturally occurring substance found in the cell walls of all crustaceans, most fungi, and the exoskeletons of most insects, 8) gamma-aminobutyric acid (GABA), 9) gibberellic acid (GA) and 10) untreated control. The experiments will be conducted with rooted clones of a certified high-CBD cultivar, Duchess. At the two-leaf stage (3 weeks post-transplanting), plants will be mechanically inoculated with HLVd from our laboratory culture using sap-to-sap inoculation (described in Objective 1). Plants will be treated with chemicals based on labelled rate at 1-week, 2-weeks and 3-weeks post-mechanical inoculation. Each week, root and leaf tissues will be collected to test HLVd levels using quantitative RT-PCR (qRT-PCR) analysis (described in detail below). In addition, symptom ratings will be done every week. There will be 10 chemical treatments including healthy or uninfected control plants with 10 plants per experiment or biological replicate. The experiment will be repeated three times for a total of 300 plants. At maturity, flowers will be harvested and tested for yield and cannabinoid profiles.RNA extraction and qRT-PCR analysis. Total RNA will be extracted using Plant RNeasy kit and the RNA will be converted to cDNA using the Verso cDNA kit per the standard manufacturer's protocol. To determine the effect of chemicals in reducing HLVd levels, a TaqMan probe based qRT-PCR assay developed by TUMI genomics (https://tumigenomics.com/hop-latent-viroid-testing) will be used. The qRT-PCR assay is a highly sensitive assay that can detect as few as 7.5 viroid copies per reaction.Cannabinoid and phytohormone analysis. To analyze cannabinoid levels, approximately 300 mg hemp flower samples will be collected from three randomly chosen plants (out of 10 plants) per treatment/biological replicate. Hence, a total of 90 plants (10 treatments x 3 plants x 3 biological replicates = 90 plants). Samples will be lyophilized for 24 hours and homogenized using a bead beater (Troy, NY) and cannabinoids will be extracted using established protocols at the CSU Bioanalysis and Omics core facility. Samples will be analyzed using ultra performance liquid chromatography tandem mass spectrometry (UPLC-MS/MS) assay for 20 cannabinoids.Phytohormone levels will be analyzed in order to confirm that plant defense elicitors induced the respective phytohormone. Approximately 100 mg of leaf tissue samples from all plants similar to cannabinoid analysis (10 treatments x 3 plants x 3 replicates = 90 samples). Samples will be lyophilized for 24 hours and homogenized using a bead beater (Troy, NY) and phytohormones will be extracted using established protocols at the CSU Bioanalysis and Omics core facility. Samples will undergo UPLC-MS/MS analysis for assay for 9 phytohormones mentioned above.3. Develop effective methods to provide research-based information to hemp growers and other stakeholders.The Colorado Center for Sustainable Pest Management Website (https://agsci.colostate.edu/agbio/ipm/) will serve as a centralized repository for all extension and outreach materials (posters, factsheets publications, etc.) and to receive feedback from stakeholders.A second means of distributing information is through in-person meetings. We will organize an Annual Hemp Grower Forum at the CSU hemp field day held at the Research Center in August to discuss project findings and obtain feedback. The PDs will meet with growers and industry representatives at other venues including CSU Extension service workshops, field days, pest management professionals meeting, CSU Agricultural Extension Service (AES) meetings. Lastly, information will be communicated via extension and scientific publications.

Progress 07/01/24 to 06/30/25

Outputs
Target Audience:The target audience werehemp growers, industry agronomists, crop consultants, diagnostic labs, researchers, and other stakeholders. Outreach and education were fully integrated into our project at each step of development and execution of the objectives.Diverse and numerous multimedia and presentation strategies were used to reach our most diverse stakeholders. Wetargeted hemp producers, as well as crop advisors, crop consultants, extension personnel and hemp industry personnel(seed, genetics) with a variety of digital and traditional media. We used three main channels by which this information wasdisseminated: 1) CSU hemp entomology website https://www.csuhempentomology.com/), 2) in-person meetings, and 3) publications. The CSU hempentomology website serves asacentralized repository for all extension and outreach materials (posters, factsheets publications etc.) and to receive feedback from stakeholders. We published an article and gave several presentations: 1. Hackenberg, L**., MacWilliams, J** and Nachappa, P†. 2023. Hop latent viroid. Compendium of Cannabis Diseases. N.W. Gauthier and L. D. Thiessen (Editors). https://doi.org/10.1094/9780890546284.05.06.1 2025 Diagnostics, Diversity, and Disease Management of Emerging Disease in Hemp (Cannabis sativa). One Health Perspectives inGlobal Plant Protection Research, February 19, 2025, in Tamil Nadu Agricultural University, Coimbatore, India. 2024 Understanding the transmission of hop latent viroid (HLVd) by insect vectors and its impact on hemp. Insymposium Cannabis and Hemp Pathogens Cannabis Research Conference, Fort Collins, CO (August 2024) organized by theInstitute of Cannabis Research. Punya Nachappa. Invited presentation. Approximately 50 scientists, industry reps and otherstakeholders. 2024 Carter, O., Han, J., MacWilliams, J., and Nachappa, P. Vector competence and effect of hop latent viroid infection on cannabis aphidsand western flower thrips in hemp (Cannabis sativa).Entomological Society of America Conference, 2024, Phoenix, AZ. Changes/Problems: Nothing Reported What opportunities for training and professional development has the project provided?We trained one Postdoctoral Fellow and one master's student. The postdoctoral fellow was a co-PI on the grant and will lead the writing of the results for publication, along with the MS student. The MS student has been trained in molecular diagnostics, statistical analysis, and manuscript writing. How have the results been disseminated to communities of interest?The target audience werehemp growers, industry agronomists, crop consultants, diagnostic labs, researchers, andother stakeholders. Outreach and education were fully integrated into our project at each step of development and execution of the objectives. Diverse and numerous multimedia and presentation strategies were used to reach our most diverse stakeholders. Wetargeted hemp producers, as well as crop advisors, crop consultants, extension personnel and hemp industry personnel(seed, genetics) with a variety of digital and traditional media. We used three main channels by which this information wasdisseminated: 1) CSU hemp entomology website https://www.csuhempentomology.com/), 2) in-person meetings, and 3) publications. The CSU hempentomology website serves asacentralized repository for all extension and outreach materials (posters, factsheets publications etc.) and to receive feedback from stakeholders. We published an article and gave several presentations: 1. Hackenberg, L**., MacWilliams, J** and Nachappa, P†. 2023. Hop latent viroid. Compendium of Cannabis Diseases. N. W. Gauthier and L. D. Thiessen (Editors). https://doi.org/10.1094/9780890546284.05.06.1 2025 Diagnostics, Diversity, and Disease Management of Emerging Disease in Hemp (Cannabis sativa). One Health Perspectives inGlobal Plant Protection Research, February 19, 2025 in Tamil Nadu Agricultural University, Coimbatore, India. 2024 Understanding the transmission of hop latent viroid (HLVd) by insect vectors and its impact on hemp. Insymposium Cannabis and Hemp Pathogens Cannabis Research Conference, Fort Collins, CO (August 2024) organized by theInstitute of Cannabis Research. Punya Nachappa. Invited presentation. Approximately 50 scientists, industry reps and otherstakeholders. 2024 Carter, O., Han, J., MacWilliams, J., and Nachappa, P. Vector competence and effect of hop latent viroid infection on cannabis aphidsand western flower thrips in hemp (Cannabis sativa).Entomological Society of America Conference, 2024, Phoenix, AZ. What do you plan to do during the next reporting period to accomplish the goals?We plan to complete experiments related to the vector transmission of HLVd by aphids and thrips describe in Objective 1 of the grant.

Impacts
What was accomplished under these goals? 1. Determine modes of HLVd transmission by insect vectors, pollen, and seed. After we were awarded the grant, a paper was published showing that HLVd was pollen and seed-transmitted; hence, we did not perform these experiments. Instead, we tested the impact of HLVd on two different types of hemp-fiber/grain and CBD. We did not find a significant difference in biomass yield (n=10, t=0.03, p=0.48, df=8) in the fiber/grain cultivar or the CBD cultivar (n=16, t=0.33, p=0.37, df=14) (Fig. 2B). In the fiber/grain cultivar, comparisons of flower yield between HLVd-negative and HLVd-positive plants showed no statistically significant difference (n=10, t=0.04, p=0.48, df=8). Similarly, in the CBD cultivar, no significant difference in flower yield was found between HLVd-negative and HLVd-positive plants (n=16, t=0.31, p=0.37, df=14). Seed yield was assessed in the dual-purpose hemp cultivar which also indicated no statistically significant difference between HLVd-positive and HLVd-negative plants (n=14, U=21, z=-0.44, p=0.47). No significant differences in cannabinoid levels were observed between HLVd-infected plants and mock-inoculated controls. 2. Determine the effect of induced chemical resistance in reducing HLVd symptom development and infection levels. We tested the effect of 8 chemical elicitors in in reducing HLVd symptom development and infection levels. Chemical ElicitorDosage (mM)Solvent Mode of Action 1-Triacontanol 0.5EtOHphotosynthesis enhancer/ growth stimulant 6-Furfurylaminopurine (Kinetin)50KOHCell division promoter/ senescence delay agent 6-Benzylaminopurine50EtOH Cell division promoter/ senescence delay agent Salicylic Acid10EtOHDefense response activator/ systemic acquired resistance inducer Methyl Jasmonate 100EtOHStress response regulator/ defense gene activator Brassinolides0.2EtOHGrowth promoter/ stress tolerance enhancer. Chlormequat Chloride 10H2OGibberellin Biosynthesis inhibitor Chitosan Oligosaccharide1H2ODefense response elicitor HLVd levels in the elicitor spray treatments were not reduced compared to the respective controls; however, elicitor sprays impacted yield and cannabinoid levels. In terms of biomass yield, SA (14.92 ± 2.68 g, p = 0.02), brassinolides (12.82 ± 1.95 g, p = 0.03), and 6-benzylaminopurine (17.58 ± 4.73 g, p = 0.04) showed significant increases compared to their respective controls. Similar patterns were observed for flower yield. SA (8.13 ± 1.47 g, p = 0.02), brassinolides (6.87 ± 0.60 g, p = 0.01), and 6-benzylaminopurine (8.24 ± 1.54 g, p = 0.02) exhibited significant increases in flower production compared to their controls (Table 4). Other chemical elicitor treatments did not significantly differ in biomass and flower yield compared to controls. In contrast, SA, MeJA, brassinolides, and triacontanol significantly reduced specific cannabinoid levels compared to the controls. Notably, SA caused a marked decrease in Δ9-THC levels (237.5 ± 10.19, p=0.01) compared to the EtOH control (354.3 ± 42.49). Similar reductions were observed with MeJA (225.2 ± 28.86, p=0.02), brassinolides (263.5 ± 8.51, p=0.04), and triacontanol (228.3 ± 26.81, p=0.02). Additionally, both triacontanol and MeJA led to significant reductions in CBDA levels (37485 ± 5814, p=0.04 for triacontanol; 37984 ± 5864, p=0.04 for MeJA), suggesting a broad impact of these elicitors on cannabinoid biosynthetic pathways. Furthermore, chlormequat chloride (CCC) notably reduced CBDVA (1388 ± 146.2, p=0.03) and THCA (1007 ± 105.1, p=0.04) when compared to water controls (2299 ± 764.1; 1481± 399.8). Other treatments did not significantly affect individual cannabinoid concentrations. The yield of cannabinoids was also represented as % by dry weight of total potential after complete decarboxylation. This value is also the basis for determining compliance with regulatory thresholds. There were no significant differences in total % THC, total % CBD, and total % cannabinoids in HLVd-infected plants treated with various chemical elicitors. 3. Develop effective methods to provide research-based information to hemp growers and other stakeholders. Reported in "How have the results been disseminated to communities of interest?"

Publications