Recipient Organization
COLORADO STATE UNIVERSITY
(N/A)
FORT COLLINS,CO 80523
Performing Department
(N/A)
Non Technical Summary
Hop latent viroid (HLVd) is an emerging pathogen affecting hemp with potential to cause significant damage and crop loss. Since its initial detection in California in 2019, HLVd has been detected in all major hemp growing states including Colorado, Oregon, Washington and in Canada. Through this grant proposal, PDs at Colorado State University and collaborator at Simon Fraser University in Canada will engage internationally to develop and apply new knowledge and practices regarding HLVd to mitigate disease impact.The goals of this CARE proposal will be accomplished by three objectives:1. Determine modes of HLVd transmission by arthropod vectors, pollen, and seed.2. Determine the effect of induced chemical resistance in reducing HLVd symptom development and infection levels.3. Develop effective methods to provide research-based information to hemp growers and other stakeholders.These objectives will be addressed through laboratory and greenhouse experiments in Colorado, whereas the international collaborator will submit a separate grant application to Natural Sciences and Engineering Research Council of Canada to investigate related aspects of HLVd biology and management in addition to the current proposal. The research we propose addresses priority area, A) Plant health and production and plant products" which highlights break-through discoveries and the translation of these into plant production and protection practices. An integrative (research and extension) approach will train the next generation of scientists and new tools will be made readily available to stakeholders and put into practice.
Animal Health Component
50%
Research Effort Categories
Basic
50%
Applied
50%
Developmental
0%
Goals / Objectives
The long-term goal of thismulti-disciplinary research collaboration is to develop and apply new knowledge and practices regarding Hop latent viroid (HLVd), in an effort to manage and reduce losses to the hemp and cannabis/ marijuana industry in the U.S and worldwide.The specific objectives of this NIFA-CARE project are to:Determine modes of HLVd transmission by insect vectors, pollen, and seed.Determine the effect of induced chemical resistance in reducing HLVd symptom development and infection levels.Develop effective methods to provide research-based information to hemp growers and other stakeholders.
Project Methods
1. Determine mode of HLVd transmission by insect vectors, pollen, and seed. Methods/Techniques.HLVd inoculum and insect source. PD Nachappa's lab has a source of HLVd-infected plants (certified High-CBD cultivar, Duchess; Charlotte's Web, Fort Collins, CO) that is maintained by mechanically inoculating infected tissue onto healthy plants where hemp leaf tissues and stem infected with HLVd is ground in a mortar and pestle and the homogenate is inoculated into stem of healthy hemp plants. Various tissues including roots and leaves are tested after 2-4 weeks of inoculation to confirm presence of the viroid using RT-PCR analysis (described in detail below).HLVd transmission by hemp insects. The ability of insects to transmit HLVd will be tested in a reach-in growth chamber (8 ft2 growth area, Conviron, Canada) housed in our laboratory. Cohorts of 10 adult (2-3 days post-eclosion) aphids and thrips and larvae (2-3 stage) of corn earworm will be exposed to 3-week-old HLVd-infected hemp plants that were previously confirmed to be positive using RT-PCR. Insects will be given a 5-min acquisition access period because previous research found highest viroid acquisition at 5 min (See Recently completed activities). After the 5 min of acquisition, individuals will be collected and caged onto 3-week-old healthy hemp plants in clip cages (Bioquip, CA). The insects will be given a 48-hour inoculation access period as previously shown with viroid transmission (Antignus et al. 2007; Walia et al. 2015). After 48 hours of transmission, the leaf will be excised, and plants will be tested in two-week intervals. Tissues will be harvested from the roots and new growth for viroid detection because previous research showed that HLVd travels to the root and then through the plant (Punja, unpublished). The experiment will be repeated 25 times for each insect species.HLVd pollen and seed transmission.Experiments to determine potential for pollen and seed transmission will be performed in insect-proof cages in the greenhouse at CSU Plant Growth Facility. The high-CBD cultivar (Duchess) will be infected with HLVd as mentioned above and will be grown to maturity. Pollen will be harvested from male plants and seeds will be harvested from female plants and stored at 4°C. Pollen and seeds will also be harvested from healthy plants. Seed dissections will be performed to separate the seed coat from the testa/endosperm and embryo and tested for the presence of HLVd by RT-PCR to determine if HLVd is associated with the seed. Seed transmission rates will be determined by planting 100 seeds from infected plants. Seeds will be planted in 96-well polystyrene trays with rockwool blocks as a substrate in confined insect proof cages. Root and leaf tissue samples will be harvested at the first-leaf or true-leaf stage and analyzed for HLVd using RT-PCR. Pollen samples will be tested using RT-PCR analysis described below. Sequence analysis will be performed by direct sequencing of PCR products and sequences will be deposited in GenBank.RNA extraction and RT-PCR analysis. Total RNA will be extracted using Plant RNeasy kit (Qiagen, CA) following standard manufacturer's protocol. The RNA will be converted to cDNA using the Verso cDNA kit (Thermo FisherScientific, MA) per the standard manufacturer's protocol. The presence of HLVd will be confirmed with PCR analysis using primer set HLVd_F (CCACCGGGTAGTTTCCAACT) and HLVd_R (ATACAACTCTTGAGCGCCGA) as described in Matoušek and Patzak 2000. A sub-set of PCR amplicons from each experiment will be subjected to Sanger sequenced to confirm identity.2. Determine the effect of induced chemical resistance in reducing HLVd symptom development and infection levels.Methods/Techniques.Greenhouse experiment design. The experiments will be conducted in the greenhouse at the Plant Growth Research Facility at Colorado State University (CSU). The experimental design will be RCBD with 9 plant defense elicitors: 1) salicylic acid (SA), 2) jasmonic acid (JA), 3) abscisic acid (ABA), 4) indole-3-butric acid (IBA), 5) indole-3-acetic acid (IAA), 6) cytokinin, 7) chitosan, a naturally occurring substance found in the cell walls of all crustaceans, most fungi, and the exoskeletons of most insects, 8) gamma-aminobutyric acid (GABA), 9) gibberellic acid (GA) and 10) untreated control. The experiments will be conducted with rooted clones of a certified high-CBD cultivar, Duchess. At the two-leaf stage (3 weeks post-transplanting), plants will be mechanically inoculated with HLVd from our laboratory culture using sap-to-sap inoculation (described in Objective 1). Plants will be treated with chemicals based on labelled rate at 1-week, 2-weeks and 3-weeks post-mechanical inoculation. Each week, root and leaf tissues will be collected to test HLVd levels using quantitative RT-PCR (qRT-PCR) analysis (described in detail below). In addition, symptom ratings will be done every week. There will be 10 chemical treatments including healthy or uninfected control plants with 10 plants per experiment or biological replicate. The experiment will be repeated three times for a total of 300 plants. At maturity, flowers will be harvested and tested for yield and cannabinoid profiles.RNA extraction and qRT-PCR analysis. Total RNA will be extracted using Plant RNeasy kit and the RNA will be converted to cDNA using the Verso cDNA kit per the standard manufacturer's protocol. To determine the effect of chemicals in reducing HLVd levels, a TaqMan probe based qRT-PCR assay developed by TUMI genomics (https://tumigenomics.com/hop-latent-viroid-testing) will be used. The qRT-PCR assay is a highly sensitive assay that can detect as few as 7.5 viroid copies per reaction.Cannabinoid and phytohormone analysis. To analyze cannabinoid levels, approximately 300 mg hemp flower samples will be collected from three randomly chosen plants (out of 10 plants) per treatment/biological replicate. Hence, a total of 90 plants (10 treatments x 3 plants x 3 biological replicates = 90 plants). Samples will be lyophilized for 24 hours and homogenized using a bead beater (Troy, NY) and cannabinoids will be extracted using established protocols at the CSU Bioanalysis and Omics core facility. Samples will be analyzed using ultra performance liquid chromatography tandem mass spectrometry (UPLC-MS/MS) assay for 20 cannabinoids.Phytohormone levels will be analyzed in order to confirm that plant defense elicitors induced the respective phytohormone. Approximately 100 mg of leaf tissue samples from all plants similar to cannabinoid analysis (10 treatments x 3 plants x 3 replicates = 90 samples). Samples will be lyophilized for 24 hours and homogenized using a bead beater (Troy, NY) and phytohormones will be extracted using established protocols at the CSU Bioanalysis and Omics core facility. Samples will undergo UPLC-MS/MS analysis for assay for 9 phytohormones mentioned above.3. Develop effective methods to provide research-based information to hemp growers and other stakeholders.The Colorado Center for Sustainable Pest Management Website (https://agsci.colostate.edu/agbio/ipm/) will serve as a centralized repository for all extension and outreach materials (posters, factsheets publications, etc.) and to receive feedback from stakeholders.A second means of distributing information is through in-person meetings. We will organize an Annual Hemp Grower Forum at the CSU hemp field day held at the Research Center in August to discuss project findings and obtain feedback. The PDs will meet with growers and industry representatives at other venues including CSU Extension service workshops, field days, pest management professionals meeting, CSU Agricultural Extension Service (AES) meetings. Lastly, information will be communicated via extension and scientific publications.