Progress 05/01/23 to 04/30/24
Outputs
Target Audience:The intended audience comprises academics, researchers, students, fish farmers, feed producers, stakeholders in the aquaculture industry, water quality specialists, fish and water toxicologists, food science professionals, and the emerging cohort of scientists specializing in genome/transcriptome sequencing. Furthermore, the results of this endeavor extend beyond catfish aquaculture, offering insights applicable to various fish species such as largemouth bass, tilapia, and striped bass. Changes/Problems:
Nothing Reported
What opportunities for training and professional development has the project provided?The project provided several opportunities for training and professional development, particularly in molecular biology techniques, data analysis, and experimental design. Molecular Biology Techniques: The team members and students were involved in various molecular biology techniques such as RNA isolation, library preparation for RNA sequencing, and PCR primer design. Bioinformatics and Data Analysis: The project involved bioinformatics analysis of sequencing data, including alignment, differential expression analysis, and homology techniques. Participants learned to use software tools like Bowtie, edgeR Bioconductor package, and HMMER for sequence alignment, differential expression testing, and homology searches, respectively. The team also gained insights into interpreting results and generating phylogenetic analyses. Experimental Design and Execution: The project involved planning and executing experiments to determine LC50 values for both ammonia and iron exposure over different time intervals. We gained valuable experience in experimental design, sample preparation, and data collection, which are essential aspects of scientific research. In addition, students gained practical experience in setting up controlled experiments, maintaining water quality parameters, and monitoring fish performance during exposure periods. Additionally, they learned techniques for measuring ammonia and iron concentrations using chemical assays and interpreting toxicity results. Statistical Analysis: The calculation of LC50 values and confidence intervals involved statistical analysis using log probit analysis programs. Engaging in statistical analysis enhanced the team's ability to interpret experimental results and draw meaningful conclusions from data. How have the results been disseminated to communities of interest?PI and students involved in the project presented their findings at scientific conferences including The Association of 1890 Research Directors (ARD) Nashville, Tennessee and the Annual Rural Life conference, Arkansas. These conferences provide a platform for sharing research outcomes, discussing methodologies, and networking with other experts in the field. The project team had also organized workshops and field day to share the findings with stakeholders such as fish farmers, water quality experts and environmental agencies. These events included poster presentations, discussions, and hands-on demonstrations of the methodologies used in the study. The team had also presented the findings of this project in the Arkansas Catfish Promotion Board meeting. Presenting the findings of the project at this meeting serves as a targeted dissemination effort aimed specifically at stakeholders within the catfish industry in Arkansas. The findings of the project, particularly those related to determining the effects of environmental factors such as ammonia and iron on catfish health, have direct implications for catfish farming practices. Presenting these findings to industry stakeholders allows them to understand potential environmental risks and make informed decisions regarding water quality management and fish health protocols. What do you plan to do during the next reporting period to accomplish the goals?In the next reporting period, we aim to accomplish other sub-objectives of objective 2 which is, to examine the potential ability of different factors to increase Rh glycoproteins expression under challenging scenarios, and corresponding consequences on facilitating ammonia excretion and alleviating ammonia accumulation toxicity. Moreover, we also intend to accomplish objective 3. This focuses on assessing the accompanied effect of modulated Rh glycoprotein expression on key indices of performances at growth, physiological, biochemical and cellular level.
Impacts
What was accomplished under these goals?
For specific objective 1 (Identify and characterize Rh glycoproteins isoforms, and subcellular localization in the gills), following sub-objectives were accomplished. Determining sequence of Rh glycoproteins isoforms: Juvenile channel catfish (12-16 g) were obtained from the aquaculture research station at the University of Arkansas, Pine Bluff. These fish were held in three indoor 400 L (n= 10 per tank) flow-through tank equipped with aeration and were acclimated for a minimum of two weeks. They were fed daily until they appeared satiated with a commercial feed containing 32% crude protein (Rangen, TX, USA). The photoperiod was set at 12:12 (light/dark), and water quality parameters such as temperature, pH, dissolved oxygen, hardness, total alkalinity, and ammonia were maintained at 22 ± 2 ?C, 8.1 ± 0.2, 7.4 ± 0.4 mg/L, 45 ± 10 mg/L CaCO3, 17 ± 3 mg/L CaCO3, and 0.8 ± 0.20 mg/L, respectively. After the completion of the two-week acclimation phase, a total of 9 fish (n = 3 per tank) for each were anesthetized with a lethal dose (1 g/L) of neutralized MS-222 (ethyl 3-aminobenzoate methanesulphonic acid). Gills were dissected on ice, added to RNAlater (Invitrogen, NY, USA) and stored at 4 ºC. Gill samples were homogenized to isolate total RNA using RNeasy 96 QIAcube HT Kit (Qiagen). The integrity and quantity of the RNA samples were assessed using Agilent 2100 Bioanalyzer (Agilent Technologies, CA, USA). RNA samples were shipped on dry ice to Novogene (Sacramento, CA) for downstream molecular analyses. An equal amount of RNA from three fish (from each tank) was pooled. Thus, triplicates of RNA were used for library construction. Directional RNA-sequencing libraries were prepared for Illumina NextSeq sequencing (Hiseq2000 platform) using ScriptSeq v2 RNA-Seq Library Preparation Kit (Illumina). Sequence and Phylogenetic analysis for Rh homology The initial step involved aligning raw sequencing data to a reference transcriptome for channel catfish using Bowtie. Following this, tests for differential expression were conducted using the edgeR Bioconductor package. Subsequently, transcriptome sequences underwent HMMER-based homology techniques to identify Rh homologues in our experimental fish species. Finally, phylogenetic analysis was performed using the neighbor-joining method for both our sequences and gene sequences retrieved from NCBI. Primers were designed using the PrimerQuest Tool (Integrated DNA Technologies, Illinois, USA) as listed below Gene Sequence of Primer (5′ → 3′ ) Rhbg F: CTTCCTTTCTCCCTTCCCTTTC R: TCTCTCTCTCTCTCTCTCTCTCT Rhcg1 F: CATGGAGATGGTCAGCATAGAG R: GGAGATGAGACCACAGAAGAAC Rhcg2 F: TGGCTACCTGTTTGTCACGC R: GGATGCTCGGCGGCTTTATA For specific Objective 2 (Assess the triggering effects of various factors (feeding rations, water pH and dietary cortisol) on Rh glycoprotein isoforms expression, and the consequence on ammonia handling when catfish are challenged with elevated water ammonia and iron), the following sub-objectives were accomplished Determining 10 day and 21 day -LC50 for ammonia Following two weeks of acclimation phase in 2500 L flow-through holding tanks, fish (12-16 gm) were randomly distributed from the holding tanks into 200 L glass aquaria (n = 10), equipped with air-stone with the water quality parameters being the same as the fish holding tanks. For 10 day-LC50 values determination, following a preliminary range-finding test, fish were exposed to five distinct concentrations of total ammonia: 5, 10, 15, 20, and 30 mg/L. For 21 day-LC50 values determination, following a range finding test, five different (total) ammonia concentrations were chosen to expose the fish. These were 3, 6, 9, 12 and 15 mg/L total ammonia. Each concentration was tested in triplicate. Each exposure tank was spiked with the required amount of an NH4HCO3 stock solution. A constant concentration of ammonia was maintained throughout the experiment. Ammonia concentrations were measured (using the salicylate-hypochlorite method) each 12 h after the onset of treatment and the concentration of ammonia in the aquaria was maintained by adding an appropriate amount of the NH4HCO3 solution. All feces and other waste residue were removed daily by suction, and consequently 15-20% of the water in the aquaria was replaced with water containing the respective amount of ammonia. Water pH was monitored throughout the experimental period using a handheld pH electrode (HACH, Colorado, USA), and was maintained within the range of the control group using diluted HCl and/or KOH. During the experiment, dead fish (immobile and ceased respiratory movements) were counted every 12 h and removed immediately from the aquaria. For 10 day-LC50 assays, mortality was recorded after 12 hrs, day 1, day 2, day 3, and up to day 10; whereas for 21 day-LC50, the mortality was recorded up to 21 days. The 10 day and 21 day- LC50 for ammonia with upper and lower 95% confidence intervals were calculated using a log probit analysis program. Result The 10 day-LC50 value of ammonia was found to be 15.34 mg/L (C.I. 11.28-19.31 mg/L). However. 21 day-LC50 value for ammonia was determined to be 8.89 mg/L (C.I. 5.00- 12.69 mg/L). Determining 10 day and 21 day LC50 for iron Acclimated fish (as mentioned above) were stocked into 200 L glass aquaria (n = 10), equipped with air-stone. For 10 day-LC50 values determination, following a range finding test, fish were exposed to five iron concentrations: 5, 10, 15, 20 and 25 mg/L. Likewise, for 21 day-LC50 determination, five different iron concentrations were tested: 4, 8, 12, 16 and 20 mg/L. Experimental groups exposed to various iron concentrations were conducted in triplicate. Iron concentrations were achieved by adding appropriate volumes of an iron stock solution prepared with FeCl3.6H2O (ACROS Organics, USA). A consistent iron concentration was maintained throughout the experiment. Iron concentrations were measured (using the FerroZine method, Hach Method 8147 and by flame atomic absorption spectrophotometry, iCE 3000 series, Thermo Scientific, USA) every 24 h after the onset of exposure. Adjustments to the iron concentration in the aquaria were made as necessary by adding calculated amounts of the FeCl3.6H2O stock solution. Daily, feces were extracted via suction, and as a result, 10-15% of the water was replenished with fresh water containing the designated iron concentration corresponding to the respective exposure. Mortality was assessed at 12 hrs, day 1, day 2, day 3, up to day 10 or day 21 post-exposure. The 10 day and 21 day-LC50 value (with 95% confidence intervals) were calculated using a log Probit Analysis (USEPA) program. Result The 10 day-LC50 value of iron (Fe3+) was found to be 13.97 mg/L (C.I. 10.62-17.27 mg/L). However. 21 day-LC50 value for iron (Fe3+) was determined to be 8.41 mg/L (C.I. 5.29- 11.60 mg/L).
Publications
|