Progress 12/01/22 to 11/30/23
Outputs
Target Audience:Stakeholders including the scientific community, agricultural community, policy makers and the public. Changes/Problems:1. The iChrome MLE laser bank for this project was broken. It is being repaired by the manufacturer. As this equipment is essential for the fluorescence in situ hybridization (FISH) experiments, the progress of FISH measurements has been significantly affected. 2. Student transition in Dr. Zhang's lab delayed the experiment with reuse treatment. What opportunities for training and professional development has the project provided?This project has provided opportunities for training and professional development for one M.S. student (Ms. Celestene Sebag) and one Ph.D student (Ms. Samia Parveen) under the supervision of PI Dr. Zhang, four Ph.D. student (Ms. Amani Jereb, Ms. Diksha Shrestha, Mr. Michael Stewart and Mr. Hemanta Pradhan) in the laboratory of Co-PI Dr. Wang, and one Ph.D. student ((Mr. Nathaniel Elliott) under Dr. Savin. Dr. Zhang's student was responsible for collecting field samples and conducting DNA extraction and qPCR. Both Dr. Wang's students were trained in the areas of bacterial growth, gel electrophoresis, plasmid extraction, conventional and quantitative polymerase chain reaction (PCR and qPCR), fluorescence microscopy, fluorescence in situ hybridization (FISH), super-resolution fluorescence imaging, and single-particle tracking. Dr. Savin's student is trained in the areas of bacterial growth, gel electrophoresis, plasmid extraction, primer design, and quantitative polymerase chain reaction (qPCR). The student has spent a considerable amount of time during the past year in method development for extracting and separating intracellular and extracellular DNA from environmental water samples. Mr. Elliott is gaining expertise in environmental sampling and extraction and laboratory protocol development to enhance recovery from environmental samples. How have the results been disseminated to communities of interest?Publications Rogers A, Niyonshuti II, Ou J, Shrestha D, Okyere D, Chen J, Wang Y. The Shape Modulation of Laser-Induced Nanowelded Microstructures Using Two Colors. Colloids and Interfaces, 2023; 7:67. Shrestha D, Ou J, Rogers A, Jereb A, Okyere D, Chen J, Wang Y. Bacterial mobility and motility in porous media mimicked by microspheres. Colloids and Surfaces B: Biointerfaces, 2023, 222:113128. Presentations Wang, Y. "Bacterial Motility and Protein Diffusion: Understanding Bacterial Responses to Silver and Temperature", Invited Talk, Department of Biochemistry & Molecular Biology Department, UAMS, Little rock, AR, October 11, 2023. Rogers, A., Niyonshuti, I.I., Ou, J., Shrestha, D., Chen, J., Wang, Y. "Wavelength dependence of laser-induced nanowelding on silver nanoparticles", Talk, American Physical Society Annual Meeting, Las Vegas, NV, March 8, 2023. Shrestha, D., Ou, J., Rogers, A., Jereb, A., Wang, Y. "Bacterial mobility and motility in porous media mimicked by microspheres", Poster, Biophysical Society Annual Meeting, San Diego, CA, February 22, 2023. Elliott, N.E., C.A. Sebag, W. Zhang, and M.C. Savin. 2023. Detecting Extracellular Antimicrobial Resistance Genes in Reuse Water Systems. Graduate Student Poster Competition, Arkansas Discovery Farms: Collaborative Conservation Conference, Little Rock, AR, Feb 15-16, 2023. Elliott, N.E., and M.C. Savin. 2023. Recovery of extracellular antimicrobial resistance genes in agricultural waters. American Society for Microbiology, South Central Branch Annual Meeting, Little Rock, AR, November 9-11, 2023, p. 46. What do you plan to do during the next reporting period to accomplish the goals? Continue to apply the FISH-based method to measuring intra-cellular and extra-cellular ARGs in different water samples. Continue to examine bacterial motility in different real soil samples. Continue to measure intra- and extra-ARGs from reuse water samples. Continue with sediment and nutrient experiments. Finalize project and submit manuscripts for publication.
Impacts
What was accomplished under these goals?
1. Quantified the extra- and intra-cellular ARGs in water samples We applied the previously developed protocols for quantifying extra- and intra-cellular ARGs in water samples. The water samples were collected from Lake Fayetteville. The water samples were first concentrated by 40 times, followed by the developed protocols for QPCR measurements of ARGs. We tested 7 ARGs: ermF, vanA, sul1, sul2, mecA, tetO, and tetA. Extra-cellular vanA and tetO were positive, while intra-cellular ermF and vanA were positive. Negative results were obtained for extra-cellular ermF, mecA, and tetA, and intra-cellular mecA, tetO, and tetA. A manuscript from this work is currently in preparation and will be submitted soon. 2. Examined the motion of bacteria in soil-like porous media mimicked by microspheres The motion of bacteria in soil and sediments is a significant factor for determining the fate of intra-cellular ARGs. We investigated the motion of E. coli bacteria in soil-like porous media mimicked by microspheres (6 μm), using fluorescence microscopy. We observed that the bacteria slowed down significantly as the density of microspheres increased. Additionally, we found that the bacteria exhibited larger and more frequent directional changes as the density of microspheres increased. More importantly, we established and quantified the correlation between the bacterial trapping in the soil-like porous media and the geometric confinement imposed by the microspheres. Our results showed that bacterial motility remains similar in soil-like porous media, but bacterial mobility was significantly affected by the pore-scale confinement. A journal article (Shrestha et al. 2023) was published in the current reporting period. 3. Quantified the motion of bacteria in real soil samples In addition to the soil-like porous media mimicked by microspheres, we collected real soil samples from different locations in Arkansas and examined the bacterial motion in soil of different types (agriculture soil, pine forest soil, wetland soil, Sharkey clay soil, Desha clay soil). As certain soil particles are auto-fluorescent in blue and green, we transformed our model bacteria, E. coli, with a plasmid expressing red fluorescent proteins. By quantifying the motion of E. coli bacteria in different soil, we found that bacterial speed decreased in the soil of different types (e.g., decreased by >60% in clay soils). Additionally, it was measured that, at the same concentration of soils, the speed of bacteria correlated positively with the size of soil particles. In contrast, the directional change of bacteria increased as the size of soil particles decreased. A manuscript from this work is currently in preparation and will be submitted in 2024. 4. Improved separation protocol and tested water samples from reuse plant. We tested various separation protocol to separate intra- and extracellular ARGs. The improved separation protocol starts with concentrating water samples using ultrafiltration, filtration for the intracellular ARGs, and then elution for extracellular ARGs. The reuse water samples were measured for total ARGs, and will be measured for intra- and extracellular portions soon with the improved separation protocol. 5. Started the soil-ARG experiments Soil and water samples were collected from poultry and cattle farms and processed through the proposed separation protocol for intra- and extracellular ARGs. Seven ARGs including ermF, vanA, sul1, sul2, mecA, tetO, and tetA were measured from the collected samples. In the meantime, experiments with different nutrient levels are under way.
Publications
- Type:
Journal Articles
Status:
Published
Year Published:
2023
Citation:
Rogers A, Niyonshuti II, Ou J, Shrestha D, Okyere D, Chen J, Wang Y. The Shape Modulation of Laser-Induced Nanowelded Microstructures Using Two Colors. Colloids and Interfaces, 2023; 7:67.
- Type:
Journal Articles
Status:
Published
Year Published:
2023
Citation:
Shrestha D, Ou J, Rogers A, Jereb A, Okyere D, Chen J, Wang Y. Bacterial mobility and motility in porous media mimicked by microspheres. Colloids and Surfaces B: Biointerfaces, 2023, 222:113128.
- Type:
Conference Papers and Presentations
Status:
Published
Year Published:
2023
Citation:
Rogers, A., Niyonshuti, I.I., Ou, J., Shrestha, D., Chen, J., Wang, Y. Wavelength dependence of laser-induced nanowelding on silver nanoparticles , Talk, American Physical Society Annual Meeting, Las Vegas, NV, March 8, 2023.
- Type:
Conference Papers and Presentations
Status:
Published
Year Published:
2023
Citation:
Shrestha, D., Ou, J., Rogers, A., Jereb, A., Wang, Y. Bacterial mobility and motility in porous media mimicked by microspheres , Poster, Biophysical Society Annual Meeting, San Diego, CA, February 22, 2023.
- Type:
Conference Papers and Presentations
Status:
Published
Year Published:
2023
Citation:
Wang, Y. Bacterial Motility and Protein Diffusion: Understanding Bacterial Responses to Silver and Temperature , Invited Talk, Department of Biochemistry & Molecular Biology Department, UAMS, Little rock, AR, October 11, 2023.
- Type:
Conference Papers and Presentations
Status:
Published
Year Published:
2023
Citation:
Elliott, N.E., C.A. Sebag, W. Zhang, and M.C. Savin. 2023. Detecting Extracellular Antimicrobial Resistance Genes in Reuse Water Systems. Graduate Student Poster Competition, Arkansas Discovery Farms: Collaborative Conservation Conference, Little Rock, AR, Feb 15-16, 2023.
- Type:
Conference Papers and Presentations
Status:
Published
Year Published:
2023
Citation:
Elliott, N.E., and M.C. Savin. 2023. Recovery of extracellular antimicrobial resistance genes in agricultural waters. American Society for Microbiology, South Central Branch Annual Meeting, Little Rock, AR, November 9-11, 2023, p. 46.
|
Progress 12/01/21 to 11/30/22
Outputs
Target Audience:Stakeholders including the scientific community, agricultural community, policy makers and the public. Changes/Problems:The sequences of primers obtained from published literature for sul1 and sul2 did not work, as false positives were measured. The primers need to be re-designed. Recovery from environmental samples has been remarkably low. Therefore, isolation of methodological components to increase recovery was necessary. Supply-chain delays also continue to slow progress. What opportunities for training and professional development has the project provided?This project has provided opportunities for training and professional development for one M.S. student (Ms. Celestene Sebag) under the supervision of PI Dr. Zhang, two Ph.D. student (Ms. Amani Jereb and Ms. Diksha Shrestha) in the laboratory of Co-PI Dr. Wang, and one Ph.D. student ((Mr. Nathaniel Elliott) under Dr. Savin. Dr. Zhang's student was responsible for collecting field samples and conducting DNA extraction and qPCR. Both Dr. Wang's students were trained in the areas of bacterial growth, gel electrophoresis, plasmid extraction, conventional and quantitative polymerase chain reaction (PCR and qPCR), fluorescence microscopy, fluorescence in situ hybridization (FISH), super-resolution fluorescence imaging, and single-particle tracking. In addition, both students were trained with computational skills for quantitative analysis of the experimental results using MATLAB and Python. Dr. Savin's student is trained in the areas of bacterial growth, gel electrophoresis, plasmid extraction, primer design, and quantitative polymerase chain reaction (qPCR). The student has spent a considerable amount of time during the past year in method development for extracting and separating intracellular and extracellular DNA from environmental water samples. Mr. Elliott is gaining expertise in environmental sampling and extraction and laboratory protocol development to enhance recovery from environmental samples. A post-doctoral research associate (Kishan Mahmud), and research technician (Timothy Glover) assisted in the project by participating in sample collection on March 3 and August 25, 2022. Sample collection is taking place on-farm with farmer cooperation at two operations of Arkansas Discovery Farms Program cooperators. How have the results been disseminated to communities of interest?The PI (Zhang)'s student has presented her research findings in an oral presentation at the 2022 Water Reuse Syposium. Celestene Sebag and Wen Zhang, "Antibiotic Resistance Genes in Agricultural Reuse Water" (oral presentation), 2022 Water Reuse Symposium. San Antonio, TX, March 7, 2022. What do you plan to do during the next reporting period to accomplish the goals?(1) Optimize the FISH-based methodologies for measuring intra-cellular and extra-cellular ARGs (Task 1) (2) Apply the QPCR-based method to measuring intra-cellular and extra-cellular ARGs in different water samples in Tasks 2 and 3. Once a method for separation, differentiation, and quantification of target ARGs has been optimized and validated it will fulfill the requirements of Task 2 and 3. Because a standardized method for the quantification of eARGs from environmental samples that includes the differentiation of bound and adsorbed fractions, does not exist, development of a method for differentiation and quantification of eARG and iARG that is essential for the successful completion of the other objectives in this study is an important focus of this project. (3) Determine if increasing nitrogen and phosphorus concentrations increases or decreases extracellular ARG presence and persistence in reuse water (Task 4 and 5) Water samples collected for this objective will include the following: cattle pond that catches runoff from a pasture, pond with a surrounding riparian buffer area, row crop runoff waters where agricultural animal additives are used including tail water from rice fields, and treated industrial agricultural effluent. Preference will be given for locations that implement reuse water practices. Water will be collected from three locations with either a meaningful presence of ARGs or an important reuse system in place. Four concentrations of nitrogen and phosphorus will be tested. Nitrogen concentrations will bracket 0.1 - 10.0 mg/L and phosphorus concentrations will bracket 0.01 -5.0 mg/L, which coincide with total nitrogen and total phosphorus data collected from across Arkansas by the Department of Environmental Quality from January, 2020 to July 2022. Concentrations will be chosen to consider resulting N:P ratios. Four parameters will be tested, those of nitrogen addition, phosphorus addition, nitrogen and phosphorus addition, and a control with no additional nitrogen or phosphorus added. Three ARGs will be used for this experiment and will be spiked into the samples as eDNA in the form of gBlockTM gene sequences. Persistence will be determined over the course of 4 weeks with 5 sampling points, twice in the first week and once in the weeks thereafter. (4) Determine if increasing sediment concentrations increase or decrease extracellular ARG presence and persistence in reuse water (Task 4 and 5) This task will focus on concentrations of sediment. Sediment used in this experiment will be sterilized silt loam (characterized for texture analysis) soil representing one of the commonly found soil textures of Arkansas soils. Soil samples will be obtained with the help of Discovery Farms or Extension personnel. Soil samples will be sterilized three times in an autoclave with a 2-day wait time between each run. Sediment concentrations will be chosen that bracket 1.0 - 100.0 mg/L, which are those commonly found in surface water across Arkansas from January, 2020 to July, 2022. This experiment will follow a similar protocol as the first experiment in Task 2.
Impacts
What was accomplished under these goals?
Tested the developed protocols for quantifying extra- and intra-cellular ARGs with QPCR using synthetic samples In the previous report, we developed a protocol for distinguishing and quantifying extra- and intra-cellular ARGs with QPCR. As a follow up, we vigorously tested the developed protocol using synthetic samples. The synthetic samples were made up by mixing plasmids with E. coli bacteria at different ratios. Both the plasmids and the bacteria carried the CmR (chloramphenicol resistance) gene. The synthetic samples then went through the developed protocol (i.e., centrifugation, wash, and filtration) and were separated into extra-cellular (EC) samples and intra-cellular (IC) samples. The EC and IC samples were then used for QPCR measurements. We observed that the measured concentration of extra- and intra-cellular CmR genes correlated very well with the concentration of plasmids and bacteria, respectively. In the log-log plots, the measured concentrations of CmR gene were almost linear to the ground-true values, for both extra-cellular and intra-cellular CmR gene. These results showed the success of the developed method and the achievement of the goal of Task 1. Applied the developed protocols for quantifying extra- and intra-cellular ARGs in water samples We further applied the developed protocols for quantifying extra- and intra-cellular ARGs in water samples. The water samples were collected from Lake Fayetteville (Site 1 of Task 2). The water samples were first concentrated by 40 times, followed by the developed protocols for QPCR measurements of ARGs. We tested 7 ARGs: ermF, vanA, sul1, sul2, mecA, tetO, and tetA, Extra-cellular vanA and tetO were positive, while intra-cellular ermF and vanA were positive. Negative results were obtained for extra-cellular ermF, mecA, and tetA, and intra-cellular mecA, tetO, and tetA. Results for sul1 and sul2 were problematic, as the negative control without the water samples showed positive QPCR results, indicating that the primers for these two genes (obtained from published literature) may need to be improved. Tested the FISH protocol for intra-cellular ARG quantification in synthetic samples The designed library of FISH probes were fluorescently labeled with Quasar 570 dyes, and used for label the CmR genes in synthetic samples (i.e., containing E. coli bacteria with or without the CmR gene). Briefly, the intra-cellular samples were fixed by formaldehyde and permeabilized by ethanol. After heating the microbes to 95°C for 5 min, the library of fluorescent FISH probes were added to the samples, followed by slow cooling to room temperature over 12 hours. After thorough wash, the intra-cellular samples were imaged with a fluorescence microscope. We observed that the bacteria carrying the CmR gene showed ~60% higher intensity in the fluorescence than the bacteria without the CmR gene, indicating that the FISH protocol worked to some extent, while optimization may be needed for applications to water samples. Investigated the navigation of bacteria in soil-like porous media The motion of bacteria in soil and sediments is a significant factor for determining the fate of intra-cellular ARGs (part of Task 4 and 5). In the past year, we investigated the motion of bacteria in synthetic soil-like porous media using E. coli bacteria as a model system. The soil-like porous media were made of microspheres of 6 μm, and the motion of E. coli bacteria were monitored using fluorescence microscopy. Compared to bacteria in aqueous solution, we observed that the bacteria slowed down significantly as the density of microspheres increased. For example, at the highest density of microspheres used in the study, the average bacterial velocity was only 40% of that in aqueous solution. In addition, we found that the bacteria exhibited larger and more frequent directional changes as the density of microspheres increased. Such changes happened mostly around the microspheres and due to the collisions with the microspheres. More importantly, we established and quantified the correlation between the bacterial trapping in the soil-like porous media and the geometric confinement imposed by the microspheres. In addition, numerical simulations showed that the active Brownian motion model in the presence of microspheres resulted in bacterial motion that are consistent with the experimental observations. Our study suggested that it is important to distinguish the ability of bacteria to move easily - bacterial mobility - from the ability of bacteria to move independently - bacteria motility. Our results showed that bacterial motility remains similar in soil-like porous media, but bacterial mobility was significantly affected by the pore-scale confinement. Prepared groundwork for soil-ARG experiments (Task 3 and 5) Soil and water samples from two locations in Northwest AR were collected on March 9, 2022. The first location was a farm that produces broiler poultry and beef. The focus for sample collections was the soil around and the waters within a pond containing runoff from the chicken production area. The second location was a beef and sheep with rotational grazing practices. Two ponds were sampled on this property. One pond was fenced off and had limited access for livestock. Water was pumped out to watering stations in the field. The other pond was an open pond were livestock had ingress and egress access. The second farm was sampled again for soil and water on August 25, 2022 to further the work on completing objective 1. TaqMan primer and probes were designed using the PrimerQuestTM tool on the Integrated DNA Technologies website, targeting 7 antimicrobial resistance genes. Sulfonamide resistance is represented by sul1 and sul2 resistance genes, macrolides by the ermF resistance gene, tetracycline by the tet(A) and tet(O) resistance genes, glycopeptide resistance by the vanA resistance gene, and methicillin resistance by the mecA gene. Thermal conditions were determined experimentally to optimize PCR outcomes for each primer/probe pair. Primers for six antimicrobial resistance genes were optimized with similar thermal conditions and were therefore considered to be used further. The primers for vanA, however, were not shown to be effective at similar thermal conditions to the other six genes, so cannot be used in multiplex studies with the other six assays. DNA template used for optimization was gBlockTM gene fragments of target antimicrobial resistance gene (ARG) sequences ordered from Integrated DNA technologies. Each primer/probe assay was evaluated and optimized for multiplex qPCR using gBolckTM gene fragments and environmental samples. Two groups of ARG gene target sequences were used, sul1, sul2, and ermF, having FAM, HEX, and Cy5 fluorophore tags respectively, and tetA, tetO, and mecA, with Fem, Hex and Cy5 fluorophore tags respectively. Sample collected from advanced reuse treatment plant (Task 4) We collaborated with the Norman Water Reclamation Facility (Norman, OK) on the pilot testing of advanced reuse treatment. The pilot plant includes a new Ozone-BAC treatment process, and a consecutive UV-AOP process built in February 2022 by Xylem, USA. The domestic sewage undergoes the biological treatment and filtration before entering the pilot facility. It first goes through the Oxelia trailer with ozone and two biologically activated carbon (BAC) media filters, then into the MiPRO trailer for UV-AOP treatment, where UV dosage was always above 100 mJ/cm2 in conjunction with peroxide. During pilot operation, influent for the trailers was switched weekly, to study the effect of the filter types on the downstream advanced treatment processes. For this study, only the batch reactor process was sampled, and ozone dosage was adjusted from 6.3, 14, 12, and 10 ppm during the sampling period. The samples were subjected to total DNA extraction, intra- and extra-DNA separation and will be analyzed for 7 selected ARGs.
Publications
- Type:
Journal Articles
Status:
Submitted
Year Published:
2022
Citation:
Diksha Shrestha, Jun Ou, Ariel Rogers, Amani Jereb, Yong Wang. Bacterial mobility and motility in porous media mimicked by microspheres . Submitted to Colloids and Surfaces B: Biointerfaces (available on BioRxiv), 2022.
|
Progress 12/01/20 to 11/30/21
Outputs
Target Audience:Stakeholders including the scientific community, agricultural community, policy makers and the public. Changes/Problems:Tasks have been delayed for the following reasons. 1) The boarding of the two Ph.D. students was delayed due to COVID-19. One arrived in January 2021 and the other started in August 2021. 2) Partly due to COVID-19, the procurement system at UA and approval chain have been somewhat broken and causing significant delays. 3) Supplies of certain materials and supplies (e.g., 0.22 µm filters, DNA extraction kits) have been problematic and causing significant delays. What opportunities for training and professional development has the project provided?This project has provided opportunities for training and professional development for one M.S. student (Ms. Celestene Sebag) under the supervision of PI Dr. Zhang, one Ph.D. student (Ms. Amani Jereb) in the laboratory of Co-PI Dr. Wang, and one Ph.D. student under Dr. Savin. All three students were trained in the areas of bacterial growth, gel electrophoresis, plasmid extraction, conventional and quantitative polymerase chain reaction (PCR and qPCR); Amani was also trained on fluorescence microscopy, fluorescence in situ hybridization (FISH), super-resolution fluorescence imaging, single-particle tracking, and computational skills for quantitative analysis of the experimental results using MATLAB and Python. How have the results been disseminated to communities of interest?
Nothing Reported
What do you plan to do during the next reporting period to accomplish the goals?1) Continue to establish methodologies based on FISH as proposed in Task 1. 2) Cross-verify qPCR and FISH results. 3) Apply the protocol developed to different intra- and extracellular ARGs in multiple water sources (Task 2). 4) Set up RSSCTs and run depth-filtration with collected reuse water. 5) Run membrane filtration with collected reuse water. 6) Optimize protocol for elution of eDNA from colloids. 7) Determine ARG concentration from collected sediment samples.
Impacts
What was accomplished under these goals?
This project will provide critical information on the management of antibiotic resistance genes in agricultural reuse practice. The following aspects have been accomplished during this period. 1) Developed protocols for differentiating and quantifying extra- and intra-cellular ARGs using qPCR In the past 10 months, we developed protocols for differentiating and quantifying extra- and intra-cellular ARGs based on qPCR, which is the goal of Task 1. For this task, we exploited samples of known bacteria and ARGs for the test and verification on how the protocols worked. This verification system was constructed based on an E. coli wild-type strain (MG1655) and a plasmid (pHNS::mEos3.2::CmR, CmR=Chloramphenicol Resistance). Several samples were made: (S-B) MG1655 bacteria only, (S-G) pHNS::mEos3.2::CmR plasmids only , (S-BEG) MG1655 bacteria mixed with pHNS::mEos3.2::CmR plasmids, (S-BIG) MG1655 bacteria transformed with pHNS::mEos3.2::CmR plasmids, (S-BEIG) MG1655 bacteria transformed with pHNS::mEos3.2::CmR plasmids and then mixed with additional pHNS::mEos3.2::CmR plasmids. Sample S-B serves as a negative control, while Sample S-G was used for generating qPCR standard curves. Sample S-BEG contains bacteria and extracellular ARGs (i.e., CmR), S-BIG contains bacteria and intracellular ARGs, and S-BEIG contains bacteria and both extra- and intra-cellular ARGs. We generated the qPCR standard curve using extracted and purified plasmids (pHNS::mEos3.2::CmR, i.e., S-G). The purified plasmids were prepared in a 10-fold dilution series, followed by qPCR measurements using a set of primers on an Open qPCR machine (Chai Inc., USA). The threshold cycles (Cq) were determined and plotted against the concentration of CmR gene. We note that the standard curve works over 7 orders of magnitude. We also established and applied protocols for separating extra- and intra-cellular ARGs using both centrifugation and filtration. Briefly, each sample was centrifuged at 5000 rpm for 10 min. The supernatant was collected and filtered with a 0.22 µm filter, producing the extra-cellular sample (ECS). The pellet after centrifuge was washed twice by DI water and resuspended in 1 mL DI water, producing the intra-cellular sample (ICS). The ECS and ICS samples were then used for qPCR measurements. We observed that the established protocols were successful. All the samples containing the ARGs showed Cq values below 30, while those without the ARGs had Cq values above 30. We observed that the sample S-BIG-ECS was at the borderline, presumably due to the possible leakage of intra-cellular ARGs. We believe that the qPCR-based protocols are readily applicable to Task 2 and Task 3 of the project. 2) Designed fluorescent probes for FISH experiments We also designed and ordered fluorescent DNA probes for fluorescent in situ hybridization (FISH) experiments for Task 1. Sequences of 25 probes targeting the CmR gene were designed (Table 1). All the probes were labeled by Quasar 570 dyes at the ends. Table 1. Sequences of designed FISH probes. ccagtgatttttttctccat, gggatatatcaacggtggta, aaatgttctttacgatgcca, agcaactgactgaaatgcct, tgaacggtctggttataggt, acggtctttaaaaaggccgt, gccggataaaacttgtgctt, ggcgggcaagaatgtgaata, aattccggatgagcattcat, accgtctttcattgccatac, ggtgaacactatcccatatc, gtttcagtttgctcatggaa, attcactccagagcgatgaa, aaactgccggaaatcgtcgt, catcttgcgaatatatgtgt, caggttttcaccgtaacacg, ctcaataaaccctttaggga, aactggtgaaactcacccag, ccatattggccacgtttaaa, atggtgaaaacgggggcgaa, gccttgcgtataatatttgc, tgatgaacctgaatcgccag, atggaagccatcacagacgg, attcattaagcattctgccg, cactcatcgcagtactgttg, 3) Determined ARG concentrations from multiple water sources We have established qPCR standard curves for seven ARGs using gBlock gene fragments purchased from IDTDNA. They include sul1 and sul2 (resistant to sulfonamides), ermF (resistant to macrolides), tetA and tetO (resistant to tetracycline), vanA (resistant to glycopeptides), and mecA (resistance to methicillin). In the past 10 months, we took three rounds of samples from different water sources, including (1) wastewater effluent from 2 wastewater treatment plants in Fayetteville and 1 wastewater treatment plants in Springdale, (2) lake water from Beaver Lake and Lake Fayetteville, (3) agriculture pond water from Savoy farm, and (4) irrigation water from rice field trenches in eastern Arkansas. These locations provide a variety of nontraditional sources for irrigation water. Upon arrival at the research lab, the water samples were subjected to direct DNA extraction and filtration. The DNA extracts were analyzed for relative concentration of all seven ARGs using qPCR. All selected ARGs except for mecA and vanA were detected in the first round of water samples. Currently the intra- and extracellular ARGs are not differentiated in this measurement. 4) Prepared filtration setup for ARG treatment. We started acquiring supplies to set up the rapid small-scale column tests (RSSCTs), including activated carbon, glass columns, pressure gauges, pretreatment filters, pumps and accessories, etc. The M.S. student (Celestene) is getting trained on column operation and medium preparation. We expect to complete the RSSCT setup and start running the filtration test soon. 5) Prepared for ARG-soil interaction experiments A PhD student was hired in August 2021 by Co-PI Dr. Savin and has been identifying water bodies in Arkansas for sampling water and sediments. He has been preparing the laboratory with supplies and learning methodologies for sampling and preparing samples for DNA extraction and preparation. He has also been researching different protocols to elute DNA from organic and inorganic colloids.
Publications
|