Source: UNIVERSITY OF ARKANSAS submitted to
ELUCIDATING THE FATE OF INTRA- AND EXTRACELLULAR ANTIBIOTIC RESISTANCE GENES IN AGRICULTURAL REUSE WATER
Sponsoring Institution
National Institute of Food and Agriculture
Project Status
COMPLETE
Funding Source
AFRI COMPETITIVE GRANT
Reporting Frequency
Annual
Accession No.
1025022
Grant No.
2021-67019-33683
Cumulative Award Amt.
$500,000.00
Proposal No.
2020-04797
Multistate No.
(N/A)
Project Start Date
Dec 1, 2020
Project End Date
Nov 30, 2024
Grant Year
2021
Program Code
[A1411]- Foundational Program: Agricultural Water Science
Project Director
Zhang, W.
Recipient Organization
UNIVERSITY OF ARKANSAS
(N/A)
FAYETTEVILLE,AR 72703
Performing Department
Civil Engineering
Non Technical Summary
Reuse of properly treated wastewater reduces pressure on aquifers, improves sustainability of crop production, and reduces hunger by mitigating yield losses from drought; however, improper treatment also increases the risk of spreading antibiotic resistance. To sustain crop production with limited water supply, water sources including recycled wastewater, brackish groundwater, agricultural return flow, and produced water from industry must be considered. This proposal aims to investigate the fate of intra- and extracellular antibiotic resistance genes (ARG) in agricultural reuse water. Our short-term goal to determine the effectiveness of wastewater treatment technologies in reducing the size of surface water reservoirs and disrupting the spread of antibiotic resistance among environmental microbial communities will be achieved through five supporting objectives:(i) establish method to quantify ARGs in environmental samples;(ii) quantify abundance of ARGs in reuse water;(iii) examine impact of nutrients and sediment on ARG persistence in water;(iv) evaluate reuse water treatment on fate of ARGs;(v) determine persistence of ARGs in soil irrigated with reuse water.We propose a series of experiments to differentiate intra- and extracellular ARGs, evaluate nutrient and sediment drivers on persistence of ARGs in water and soil, and assess ARG fate under different reuse treatment technologies. The proposed research project addresses the Program Area Priority Water Quantity and Quality (A1411) under the Bioenergy, Natural Resources, and Environment Program with a specific focus on ensuring adequate nontraditional water irrigation practices are implemented for crop and livestock by evaluating factors impacting the fate of both intra- and extracellular ARGs.
Animal Health Component
10%
Research Effort Categories
Basic
90%
Applied
10%
Developmental
0%
Classification

Knowledge Area (KA)Subject of Investigation (SOI)Field of Science (FOS)Percent
1020210104080%
1110210104020%
Knowledge Area
102 - Soil, Plant, Water, Nutrient Relationships; 111 - Conservation and Efficient Use of Water;

Subject Of Investigation
0210 - Water resources;

Field Of Science
1040 - Molecular biology;
Goals / Objectives
The goal of this proposal is to investigate the fate of intra- and extracellular ARGs in agricultural reuse water. Our overall, long-term goal is to improve agricultural sustainability by reducing negative environmental impacts of reuse water in agricultural irrigation systems. Our short-term goal is to determine the effectiveness of reuse water treatment technologies in reducing the size of surface water reservoirs and disrupting the spread of antibiotic resistance among environmental microbial communities.Five specific supporting objectives are strategically designed to test these hypotheses, which are:(i) developing molecular techniques to quantify intra- and extracellular ARGs in environmental samples;(ii) determining the abundance of intra- and extracellular ARGs in different types of reuse water;(iii) examining the interaction between ARGs and contaminants in reuse water including nutrients and sediments;(iv) investigating the fate of ARGs during the treatment of reuse water including depth filtration, membrane filtration and disinfection;(v) studying the persistence and accumulation of ARGs in soil after irrigation with reuse water.
Project Methods
The project team selected ARGs corresponding to resistance to sulfonamides (sul1, sul2), macrolides (ermF), tetracycline [tet(A), tet(O)], glycopeptides (vanA), and methicillin (mecA) as the target genes to measure in reuse water.Task 1 is to develop molecular techniques to differentiate and quantify intra- and extracellular ARGs in environmental samples. The success of this task will provide a robust procedure to analyze ARGs in reuse water in the following tasks in this proposal.To separate the intra- and extracellular DNA in water samples, both filtration and centrifugation/chemical extraction combined with DNA extraction have been published previously. This task will test both procedures to extract and collect intra- and extracellular DNA and compare the efficacy of these two methods. To quantify the intra- and extracellular ARGs, we propose to exploit two molecular techniques: quantitative PCR (qPCR) and quantitative imaging based on fluorescence in situ hybridization (FISH). As qPCR is a standard technique to analyze DNA in microbial samples, it is expected to ensure the successful completion of this project. On the other hand, one disadvantage of qPCR is an ensemble measurement, and does not distinguish individual microbes. This disadvantage is expected to be overcome by the FISH-based quantitative imaging, which examines ARGs at the single-cell level, visualizes the ARGs in individual microbes, and provides valuable information on microbe-to-microbe variabilities.For quantification of intracellular ARGs by FISH, the collected microbes will be fixed by formaldehyde and permeabilized by ethanol. After heating the microbes to 95°C for 5 min, a library of short fluorescent DNA probes (~20 bases for each probe, conjugated to ATTO532) will be added to the samples, followed by slow cooling to room temperature over 12 hours. The library of short DNA probes is designed such that multiple probes hybridize to the ARGs of interest (typically 10-20 probes per ARG), resulting in fluorescently labeled ARGs in the microbes. The microbes will be immobilized on poly-L-Lysine coated glass coverslips, followed by imaging the microbes and quantifying ARGs using both bright-field microscopy and fluorescence microscopy. The bright-field microscopy will be used to locate the microbes, while the fluorescence microscopy will be used to examine the ARGs. By overlapping the ARGs on the microbes, we expect to determine the amount of ARGs in single microbes. In addition, if it is necessary, we will perform super-resolution fluorescence microscopy to quantify intracellular ARGs, as described in our preliminary work.For quantification of extracellular ARGs by FISH, the ARGs in the extracellular solutions of the reuse water (supernatants from centrifugation or filtrates from filtration) will be concentrated by precipitating in cold ethanol, air dried, and dissolved in water with a final volume that is 100-1000 times smaller than the original volume. Then the short fluorescent DNA probes will be added to the concentrated solutions to label the extracellular ARGs via hybridization, followed by immobilizing and imaging the labeled ARGs similar to the intracellular ARGs in microbes. As each ARG is labeled by 10-20 probes, the signal (i.e., intensity of the fluorescently labeled ARGs) will be 10-20 times higher than the noise (i.e., intensity of the unhybridized fluorescent probes). This high signal-to-noise ratio clearly distinguishes ARGs from unhybridized probes.Task 2 is to identify the presence and concentration of selected ARGs within nontraditional water sources in agriculture. The sampling locations in the northwest Arkansas area include (1) Lake Fayetteville representing surface water; (2) Beaver Lake representing surface water; (3) Westside Wastewater Treatment Plant representing treated domestic wastewater; (4) Noland Wastewater Treatment Plant representing treated wastewater from mixed domestic and industrial sources; (5) Tyson Foods plant representing treated industrial wastewater; and (6) hog farm ponds in Savoy representing agricultural wastewater. In addition, tail water from rice fields in central Arkansas will also be collected. These water samples will be processed and analyzed with the established protocols from Task 1.Task 3 is to study the interactions between ARGs and nutrients, and ARG and sediments. The variation in nutrient level (such as nitrogen (N) and phosphorus (P)) and the presence of particulate matter can affect the distribution and behavior of ARGs in reuse water. Water samples from the same sources as Task 2 will be filtered and acidified to measure dissolved and total N and P. N will be measured colorimetrically and P will be measured by inductively coupled plasma spectroscopy. Sediment will be measured as total suspended solids after oven-drying particles captured on a glass fiber filter using vacuum filtration.In addition, a set of experiments will be established with a water source indicating meaningful presence of ARGs. One experiment will modify nutrient concentrations to evaluate the fate of ARGs by 1) N addition, 2) P addition), 3) N + P additions, and 4) no N + P additions to the water. To address this, water from three sources (surface water, wastewater treatment plant, and a farm source) will be spiked with eDNA or bacteria containing ARGs at approximately 25 ng mL-1 with one of the ARGs targeted in Task 1. Persistence of ARGs will be determined at 5 time points over the course of 4 weeks, twice during week 1 followed by once per week for the next 3 weeks in 3 replications each for a total of 360 FISH and/or qPCR measurements.The second experiment will evaluate increasing sediment loads on the presence of ARGs by investigating addition of 1) small, 2) medium, 3) large, and 4) no input of sediment into the water. Sediment will be sterilized silt loam (characterized for texture analysis) because it is one of the common soil textures of Arkansas soils. Sediment concentrations will bracket those measured in surface waters across Arkansas and experiments will follow a similar protocol as described for the nutrient experiment but with double the samples.Task 4 is to investigate the fate of ARGs during the treatment of reuse water. Common treatment technologies include sedimentation, biological degradation, depth filtration, membrane filtration and disinfection. The interaction between ARGs and particular matter is to be studied in Task 3; this task will focus on the fate of ARGs in depth filtration, membrane filtration and disinfection.Task 5 will be devoted to the study of the persistence and accumulation of ARGs in soil after irrigation with reuse water. Soil will be spiked with extracellular gene fragments of ARG amplified from bacteria isolated from the environment as targeted in Task 1, or from synthetic eDNA similar to that designed by Sirois and Buckley.Five soils will be used to evaluate persistence of ARGs in eDNA after irrigation with reuse water. Soil will comprise silt loam soil from Arkansas that is typical of 1) cattle pasture, 2) riparian buffer at the edge of pasture, 3) urban/suburban residential, 4) tilled rice field with no cover crop, and 5) rice field implementing cover crop management. Soil will be collected from the surface 5 cm below any surface litter and loosely homogenized through a 2-mm sieve, and analyzed for total C and N, Mechlich-3 extractable nutrients, pH, electrical conductivity. Soil will be air-dried and water-holding capacity will be determined in order to conduct the experiment at 25%, 50% and 75% water-holding capacity. Persistence of eDNA will be determined for 4 weeks at 2 temperatures (10 and 25 °C) in both sterile and non-sterilized soils (3 replications each) with two time points measured during week 1, and then weekly measurements determined thereafter for a total of 900 qPCR and/or FISH measurements.

Progress 12/01/23 to 11/30/24

Outputs
Target Audience: Nothing Reported Changes/Problems: Nothing Reported What opportunities for training and professional development has the project provided?This project has provided opportunities for training and professional development for one M.S. student (Ms. Celestene Sebag) and one Ph.D student (Ms. Samia Parveen) under the supervision of PI Dr. Zhang, four Ph.D. student (Ms. Amani Jereb, Ms. Diksha Shrestha, Mr. Michael Stewart and Mr. Hemanta Pradhan) in the laboratory of Co-PI Dr. Wang, and one Ph.D. student ((Mr. Nathaniel Elliott) under Dr. Savin. Dr. Zhang's student was responsible for collecting field samples and conducting DNA extraction and qPCR. Both Dr. Wang's students were trained in the areas of bacterial growth, gel electrophoresis, plasmid extraction, conventional and quantitative polymerase chain reaction (PCR and qPCR), fluorescence microscopy, fluorescence in situ hybridization (FISH), super-resolution fluorescence imaging, and single-particle tracking. Dr. Savin's student is trained in the areas of bacterial growth, gel electrophoresis, plasmid extraction, primer design, and quantitative polymerase chain reaction (qPCR). The student has spent a considerable amount of time during the past year in method development for extracting and separating intracellular and extracellular DNA from environmental water samples. Mr. Elliott is gaining expertise in environmental sampling and extraction and laboratory protocol development to enhance recovery from environmental samples. How have the results been disseminated to communities of interest?Publications 1) Jereb A, Sebag C, Sadoon A, Shrestha D, Savin M, Zhang W, Wang Y. "Efficient Separation Methods for Quantifying Antibiotic Resistance Genes: Insights from Synthetic and Environmental Water Samples". Under Review, 2024. 2) Shrestha D, Mahmud K, Mortenson S, Savin M, Zhang W, Wang Y. "Bacterial motility in aqueous micro-environment with natural soil particles". Under Review, 2024. Presentations 1) Wang, Y.* "Bacterial Motility and Protein Diffusion: Understanding Bacterial Responses to Environmental Complexities and Changes", Invited Seminar, Department of Physics, University of Texas Arlington, Arlington, TX, August 21, 2024. 2) Russell, B., Rogers, A., Yoder, R., Kurilich M., Krishnamurthi, V.R., Chrn, J., Wang, Y.*, "Silver Ions Inhibit Bacterial Movement and Stall Flagellar Motor", Talk, American Physical Society Annual Meeting, Minneapolis, MN, March 04, 2024. 3) Shrestha, D.*, Ou, J., Rogers, A., Jereb, A., Okyere, D., Chen, J., Wang, Y., "Bacterial Mobility and Motility in Porous Media Mimicked by Microspheres", Poster, Biophysical Society Annual Meeting, Philadelphia, PA, February 14, 2024. 4) Elliott, N.E., W. Zhang, Y. Wang, B. Haggard, B. Austin, and M.C. Savin. "Extracellular Antimicrobial Resistance Gene Concentrations in Five Agricultural Waters in Northwest and Northeast Arkansas". Presented at the Arkansas Agriculture, Forests, and Water Conference, Fayetteville, AR, July 16, 2024. 5) Parveen, S.,Elliott, N.E., M.C. Savin and W. Zhang. "Separation of intra- and extracellular antibiotic resistance genes in aquatic environment".Presented at the Arkansas Agriculture, Forests, and Water Conference, Fayetteville, AR, July 16, 2024. What do you plan to do during the next reporting period to accomplish the goals?As we wrap up this project, we will finish experiments and data analysis. The plan is for two more presentations at national professional meetings, five manuscripts submitted for publication, and two completed dissertations in 2025.

Impacts
What was accomplished under these goals? (1) Quantified the extra- and intra-cellular ARGs in water samples We quantified extra- and intra-cellular ARGs in synthetic and natural water samples. The natural water samples were collected from Lake Fayetteville. We tested 7 ARGs: ermF, vanA, sul1, sul2, mecA, tetO, and tetA. Extra-cellular vanA and tetO were positive, while intra-cellular ermF and vanA were positive. Negative results were obtained for extra-cellular ermF, mecA, and tetA, and intra-cellular mecA, tetO, and tetA. A manuscript from this work is currently under review. (2) Quantified the motion of bacteria in natural soil samples We examined the motility of E. coli bacteria in aqueous micro-environment with natural soil particles and determined how particle size distribution and arrangement influence their motility. Negative correlations were observed for the bacterial velocity with the compactness of particle arrangements. Additionally, bacteria in soil solutions with tighter pore structures showed rapid directional changes due to frequent encounters with the physical barriers posed by the soil particles. These results emphasize the broader ecological significance of bacterial activity in soil systems and are expected to facilitate better understanding of bacterial motility in both natural and simulated soil micro-environment. A manuscript from this work is currently under review. (3) Examined the growth and motility of freshwater microalgae We also investigated the growth of motility of C. reinhardtii microalgae, which are commonly found in freshwater bodies, such as lakes, ponds, and rivers, and how they change in the presence of heavy metal ions. We found that the lag phase of the microalgal growth was extended as the concentration of metal ions increased. However, at low concentrations of silver ions, the stationary growth of the microalgae was boosted, which indicated a possible hormetic response. In addition, we determined the effects of heavy metal ions on the swimming motility of C. reinhardtii, and observed that the speed of the microalgae decreased over time in the presence of metal ions. A manuscript from this work is currently in preparation and will be submitted to a scientific journal for publication in 2025. (4)) Separation method development To understand the fate of extracellular antimicrobial resistance genes (eARGs) in turbid agricultural reuse water, a sample processing method was developed that included collection of cattle pond water (10 L), tandem ultrafiltration, trypsinization and fractionation by centrifugation, DNA extraction, and quantification by qPCR. Various steps of the protocol were evaluated to distinguish and measure recovery of known concentration of a plasmid-encoded target (sul1) antimicrobial resistance gene (ARG) as free aqueous extracellular antimicrobial resistance genes (feARGs), sorbed extracellular antimicrobial resistance genes (seARGs), and intracellular antimicrobial resistance genes (iARGs). Potential of biotic up-take or degradation versus sorption to explain reduced eARG recovery was evaluated by comparing results from sterilized and non-sterile water samples. The sul1 gene fragment, when spiked into 18 MOhm water, was recovered at 97.8% on the second ultrafilter in the tandem filtration process, which was in place to retain feARGs. The first filter is meant to retain iARGs and seARGs and resulted in 2.2 % recovery of the added sul1 gene. Results demonstrate that the majority of feARGS will flow through the first filter meant to retain iARGs and seARGs and will be recovered by the second filter in this setup. We also tested different extraction methods for iARGs and eARGs. We extracted iARGs using Omega Bacterial DNA kit as well as Boiled DNA approach where we got higher recovery rate using Omega kit (~20%) than Boil DNA approach (~16%). Simultaneously, we extracted eARGs directly using DNA extraction kits yielding poor recovery rate (<4%). Hence, we concentrated the water sample and later extracted the eARGs using three approaches: 1) Concentration using Amicon Filter with DNA extraction via Omega kit, 2) Concentration using Ultrafiltration with DNA extraction via Qiagen kit, and 3) Concentration using Nucleic acid adsorption particles (NAAPs) with DNA extraction via Alcohol Precipitation. The NAAP method yielded higher recovery rate (~80%) whereas the other two approaches yielded like (~7%). These results suggest using NAAPs with alcohol precipitation for eARG extraction along with Omega Bacterial kit for iARG extraction. A manuscript from this work is currently in preparation and will be submitted to a scientific journal for publication in 2025. (5) Agricultural eARG quantification Antimicrobial resistance genes were quantified from five sources in Arkansas representing a variety of land usages. Three locations in Northwest Arkansas were livestock ponds that captured runoff from surrounding fields from which water was then used for livestock. The fourth location was a water drainage system in Northeast Arkansas that contained tail waters from surrounding rice ponds that received animal waste as a soil amendment. The final location was a recreational lake in Northwest Arkansas. Three 10-L samples were collected for ARG detection along with three 1-L samples at each location for measurement of water quality properties. Electrical conductivity (EC), pH, total suspended solids (TSS), dissolved oxygen (DO), E. coli levels (CFU), nitrate, ammonia, soluble reactive phosphorus (SRP), total nitrogen (TN), and total phosphorus (TP) were determined for each water source. Data are being analyzed for relationships such as environmental factors that serve as predictor variables and concentrations of the different ARG fractions. (6) Effect of nutrients on detection of antimicrobial resistance genes To determine the effect of increased nutrient concentrations and change in N:P ratios on eARG recovery, nutrients were added to cattle pond water, which was subsequently spiked with known concentration of a plasmid-encoded sul1 gene. Early results from a preliminary study showed that the feARGs comprised the smallest fraction of total ARGs, while iARGs comprised the largest proportion of total ARGs detected. Overall, total ARG concentrations declined between 6 and 96 hours, with iARGs increasing in proportion of the total as time increased to 10 days post-spiking. Results are being analyzed as qPCR are being completed.

Publications

  • Type: Conference Papers and Presentations Status: Published Year Published: 2024 Citation: 1) Wang, Y.* Bacterial Motility and Protein Diffusion: Understanding Bacterial Responses to Environmental Complexities and Changes, Invited Seminar, Department of Physics, University of Texas Arlington, Arlington, TX, August 21, 2024.
  • Type: Conference Papers and Presentations Status: Published Year Published: 2024 Citation: 2) Russell, B., Rogers, A., Yoder, R., Kurilich M., Krishnamurthi, V.R., Chrn, J., Wang, Y.*, Silver Ions Inhibit Bacterial Movement and Stall Flagellar Motor, Talk, American Physical Society Annual Meeting, Minneapolis, MN, March 04, 2024.
  • Type: Conference Papers and Presentations Status: Published Year Published: 2024 Citation: 3) Shrestha, D.*, Ou, J., Rogers, A., Jereb, A., Okyere, D., Chen, J., Wang, Y., Bacterial Mobility and Motility in Porous Media Mimicked by Microspheres, Poster, Biophysical Society Annual Meeting, Philadelphia, PA, February 14, 2024.
  • Type: Conference Papers and Presentations Status: Published Year Published: 2024 Citation: 4) Elliott, N.E., W. Zhang, Y. Wang, B. Haggard, B. Austin, and M.C. Savin. Extracellular Antimicrobial Resistance Gene Concentrations in Five Agricultural Waters in Northwest and Northeast Arkansas. Presented at the Arkansas Agriculture, Forests, and Water Conference, Fayetteville, AR, July 16, 2024.
  • Type: Conference Papers and Presentations Status: Published Year Published: 2024 Citation: Parveen, S., Elliott, N.E., M.C. Savin and W. Zhang. "Separation of intra- and extracellular antibiotic resistance genes in aquatic environment", poster presentation, Arkansas Agriculture, Forests, and Water Conference, Fayetteville, AR, July 16, 2024.


Progress 12/01/22 to 11/30/23

Outputs
Target Audience:Stakeholders including the scientific community, agricultural community, policy makers and the public. Changes/Problems:1. The iChrome MLE laser bank for this project was broken. It is being repaired by the manufacturer. As this equipment is essential for the fluorescence in situ hybridization (FISH) experiments, the progress of FISH measurements has been significantly affected. 2. Student transition in Dr. Zhang's lab delayed the experiment with reuse treatment. What opportunities for training and professional development has the project provided?This project has provided opportunities for training and professional development for one M.S. student (Ms. Celestene Sebag) and one Ph.D student (Ms. Samia Parveen) under the supervision of PI Dr. Zhang, four Ph.D. student (Ms. Amani Jereb, Ms. Diksha Shrestha, Mr. Michael Stewart and Mr. Hemanta Pradhan) in the laboratory of Co-PI Dr. Wang, and one Ph.D. student ((Mr. Nathaniel Elliott) under Dr. Savin. Dr. Zhang's student was responsible for collecting field samples and conducting DNA extraction and qPCR. Both Dr. Wang's students were trained in the areas of bacterial growth, gel electrophoresis, plasmid extraction, conventional and quantitative polymerase chain reaction (PCR and qPCR), fluorescence microscopy, fluorescence in situ hybridization (FISH), super-resolution fluorescence imaging, and single-particle tracking. Dr. Savin's student is trained in the areas of bacterial growth, gel electrophoresis, plasmid extraction, primer design, and quantitative polymerase chain reaction (qPCR). The student has spent a considerable amount of time during the past year in method development for extracting and separating intracellular and extracellular DNA from environmental water samples. Mr. Elliott is gaining expertise in environmental sampling and extraction and laboratory protocol development to enhance recovery from environmental samples. How have the results been disseminated to communities of interest?Publications Rogers A, Niyonshuti II, Ou J, Shrestha D, Okyere D, Chen J, Wang Y. The Shape Modulation of Laser-Induced Nanowelded Microstructures Using Two Colors. Colloids and Interfaces, 2023; 7:67. Shrestha D, Ou J, Rogers A, Jereb A, Okyere D, Chen J, Wang Y. Bacterial mobility and motility in porous media mimicked by microspheres. Colloids and Surfaces B: Biointerfaces, 2023, 222:113128. Presentations Wang, Y. "Bacterial Motility and Protein Diffusion: Understanding Bacterial Responses to Silver and Temperature", Invited Talk, Department of Biochemistry & Molecular Biology Department, UAMS, Little rock, AR, October 11, 2023. Rogers, A., Niyonshuti, I.I., Ou, J., Shrestha, D., Chen, J., Wang, Y. "Wavelength dependence of laser-induced nanowelding on silver nanoparticles", Talk, American Physical Society Annual Meeting, Las Vegas, NV, March 8, 2023. Shrestha, D., Ou, J., Rogers, A., Jereb, A., Wang, Y. "Bacterial mobility and motility in porous media mimicked by microspheres", Poster, Biophysical Society Annual Meeting, San Diego, CA, February 22, 2023. Elliott, N.E., C.A. Sebag, W. Zhang, and M.C. Savin. 2023. Detecting Extracellular Antimicrobial Resistance Genes in Reuse Water Systems. Graduate Student Poster Competition, Arkansas Discovery Farms: Collaborative Conservation Conference, Little Rock, AR, Feb 15-16, 2023. Elliott, N.E., and M.C. Savin. 2023. Recovery of extracellular antimicrobial resistance genes in agricultural waters. American Society for Microbiology, South Central Branch Annual Meeting, Little Rock, AR, November 9-11, 2023, p. 46. What do you plan to do during the next reporting period to accomplish the goals? Continue to apply the FISH-based method to measuring intra-cellular and extra-cellular ARGs in different water samples. Continue to examine bacterial motility in different real soil samples. Continue to measure intra- and extra-ARGs from reuse water samples. Continue with sediment and nutrient experiments. Finalize project and submit manuscripts for publication.

Impacts
What was accomplished under these goals? 1. Quantified the extra- and intra-cellular ARGs in water samples We applied the previously developed protocols for quantifying extra- and intra-cellular ARGs in water samples. The water samples were collected from Lake Fayetteville. The water samples were first concentrated by 40 times, followed by the developed protocols for QPCR measurements of ARGs. We tested 7 ARGs: ermF, vanA, sul1, sul2, mecA, tetO, and tetA. Extra-cellular vanA and tetO were positive, while intra-cellular ermF and vanA were positive. Negative results were obtained for extra-cellular ermF, mecA, and tetA, and intra-cellular mecA, tetO, and tetA. A manuscript from this work is currently in preparation and will be submitted soon. 2. Examined the motion of bacteria in soil-like porous media mimicked by microspheres The motion of bacteria in soil and sediments is a significant factor for determining the fate of intra-cellular ARGs. We investigated the motion of E. coli bacteria in soil-like porous media mimicked by microspheres (6 μm), using fluorescence microscopy. We observed that the bacteria slowed down significantly as the density of microspheres increased. Additionally, we found that the bacteria exhibited larger and more frequent directional changes as the density of microspheres increased. More importantly, we established and quantified the correlation between the bacterial trapping in the soil-like porous media and the geometric confinement imposed by the microspheres. Our results showed that bacterial motility remains similar in soil-like porous media, but bacterial mobility was significantly affected by the pore-scale confinement. A journal article (Shrestha et al. 2023) was published in the current reporting period. 3. Quantified the motion of bacteria in real soil samples In addition to the soil-like porous media mimicked by microspheres, we collected real soil samples from different locations in Arkansas and examined the bacterial motion in soil of different types (agriculture soil, pine forest soil, wetland soil, Sharkey clay soil, Desha clay soil). As certain soil particles are auto-fluorescent in blue and green, we transformed our model bacteria, E. coli, with a plasmid expressing red fluorescent proteins. By quantifying the motion of E. coli bacteria in different soil, we found that bacterial speed decreased in the soil of different types (e.g., decreased by >60% in clay soils). Additionally, it was measured that, at the same concentration of soils, the speed of bacteria correlated positively with the size of soil particles. In contrast, the directional change of bacteria increased as the size of soil particles decreased. A manuscript from this work is currently in preparation and will be submitted in 2024. 4. Improved separation protocol and tested water samples from reuse plant. We tested various separation protocol to separate intra- and extracellular ARGs. The improved separation protocol starts with concentrating water samples using ultrafiltration, filtration for the intracellular ARGs, and then elution for extracellular ARGs. The reuse water samples were measured for total ARGs, and will be measured for intra- and extracellular portions soon with the improved separation protocol. 5. Started the soil-ARG experiments Soil and water samples were collected from poultry and cattle farms and processed through the proposed separation protocol for intra- and extracellular ARGs. Seven ARGs including ermF, vanA, sul1, sul2, mecA, tetO, and tetA were measured from the collected samples. In the meantime, experiments with different nutrient levels are under way.

Publications

  • Type: Journal Articles Status: Published Year Published: 2023 Citation: Rogers A, Niyonshuti II, Ou J, Shrestha D, Okyere D, Chen J, Wang Y. The Shape Modulation of Laser-Induced Nanowelded Microstructures Using Two Colors. Colloids and Interfaces, 2023; 7:67.
  • Type: Journal Articles Status: Published Year Published: 2023 Citation: Shrestha D, Ou J, Rogers A, Jereb A, Okyere D, Chen J, Wang Y. Bacterial mobility and motility in porous media mimicked by microspheres. Colloids and Surfaces B: Biointerfaces, 2023, 222:113128.
  • Type: Conference Papers and Presentations Status: Published Year Published: 2023 Citation: Rogers, A., Niyonshuti, I.I., Ou, J., Shrestha, D., Chen, J., Wang, Y. Wavelength dependence of laser-induced nanowelding on silver nanoparticles, Talk, American Physical Society Annual Meeting, Las Vegas, NV, March 8, 2023.
  • Type: Conference Papers and Presentations Status: Published Year Published: 2023 Citation: Shrestha, D., Ou, J., Rogers, A., Jereb, A., Wang, Y. Bacterial mobility and motility in porous media mimicked by microspheres, Poster, Biophysical Society Annual Meeting, San Diego, CA, February 22, 2023.
  • Type: Conference Papers and Presentations Status: Published Year Published: 2023 Citation: Wang, Y. Bacterial Motility and Protein Diffusion: Understanding Bacterial Responses to Silver and Temperature, Invited Talk, Department of Biochemistry & Molecular Biology Department, UAMS, Little rock, AR, October 11, 2023.
  • Type: Conference Papers and Presentations Status: Published Year Published: 2023 Citation: Elliott, N.E., C.A. Sebag, W. Zhang, and M.C. Savin. 2023. Detecting Extracellular Antimicrobial Resistance Genes in Reuse Water Systems. Graduate Student Poster Competition, Arkansas Discovery Farms: Collaborative Conservation Conference, Little Rock, AR, Feb 15-16, 2023.
  • Type: Conference Papers and Presentations Status: Published Year Published: 2023 Citation: Elliott, N.E., and M.C. Savin. 2023. Recovery of extracellular antimicrobial resistance genes in agricultural waters. American Society for Microbiology, South Central Branch Annual Meeting, Little Rock, AR, November 9-11, 2023, p. 46.


Progress 12/01/21 to 11/30/22

Outputs
Target Audience:Stakeholders including the scientific community, agricultural community, policy makers and the public. Changes/Problems:The sequences of primers obtained from published literature for sul1 and sul2 did not work, as false positives were measured. The primers need to be re-designed. Recovery from environmental samples has been remarkably low. Therefore, isolation of methodological components to increase recovery was necessary. Supply-chain delays also continue to slow progress. What opportunities for training and professional development has the project provided?This project has provided opportunities for training and professional development for one M.S. student (Ms. Celestene Sebag) under the supervision of PI Dr. Zhang, two Ph.D. student (Ms. Amani Jereb and Ms. Diksha Shrestha) in the laboratory of Co-PI Dr. Wang, and one Ph.D. student ((Mr. Nathaniel Elliott) under Dr. Savin. Dr. Zhang's student was responsible for collecting field samples and conducting DNA extraction and qPCR. Both Dr. Wang's students were trained in the areas of bacterial growth, gel electrophoresis, plasmid extraction, conventional and quantitative polymerase chain reaction (PCR and qPCR), fluorescence microscopy, fluorescence in situ hybridization (FISH), super-resolution fluorescence imaging, and single-particle tracking. In addition, both students were trained with computational skills for quantitative analysis of the experimental results using MATLAB and Python. Dr. Savin's student is trained in the areas of bacterial growth, gel electrophoresis, plasmid extraction, primer design, and quantitative polymerase chain reaction (qPCR). The student has spent a considerable amount of time during the past year in method development for extracting and separating intracellular and extracellular DNA from environmental water samples. Mr. Elliott is gaining expertise in environmental sampling and extraction and laboratory protocol development to enhance recovery from environmental samples. A post-doctoral research associate (Kishan Mahmud), and research technician (Timothy Glover) assisted in the project by participating in sample collection on March 3 and August 25, 2022. Sample collection is taking place on-farm with farmer cooperation at two operations of Arkansas Discovery Farms Program cooperators. How have the results been disseminated to communities of interest?The PI (Zhang)'s student has presented her research findings in an oral presentation at the 2022 Water Reuse Syposium. Celestene Sebag and Wen Zhang, "Antibiotic Resistance Genes in Agricultural Reuse Water" (oral presentation), 2022 Water Reuse Symposium. San Antonio, TX, March 7, 2022. What do you plan to do during the next reporting period to accomplish the goals?(1) Optimize the FISH-based methodologies for measuring intra-cellular and extra-cellular ARGs (Task 1) (2) Apply the QPCR-based method to measuring intra-cellular and extra-cellular ARGs in different water samples in Tasks 2 and 3. Once a method for separation, differentiation, and quantification of target ARGs has been optimized and validated it will fulfill the requirements of Task 2 and 3. Because a standardized method for the quantification of eARGs from environmental samples that includes the differentiation of bound and adsorbed fractions, does not exist, development of a method for differentiation and quantification of eARG and iARG that is essential for the successful completion of the other objectives in this study is an important focus of this project. (3) Determine if increasing nitrogen and phosphorus concentrations increases or decreases extracellular ARG presence and persistence in reuse water (Task 4 and 5) Water samples collected for this objective will include the following: cattle pond that catches runoff from a pasture, pond with a surrounding riparian buffer area, row crop runoff waters where agricultural animal additives are used including tail water from rice fields, and treated industrial agricultural effluent. Preference will be given for locations that implement reuse water practices. Water will be collected from three locations with either a meaningful presence of ARGs or an important reuse system in place. Four concentrations of nitrogen and phosphorus will be tested. Nitrogen concentrations will bracket 0.1 - 10.0 mg/L and phosphorus concentrations will bracket 0.01 -5.0 mg/L, which coincide with total nitrogen and total phosphorus data collected from across Arkansas by the Department of Environmental Quality from January, 2020 to July 2022. Concentrations will be chosen to consider resulting N:P ratios. Four parameters will be tested, those of nitrogen addition, phosphorus addition, nitrogen and phosphorus addition, and a control with no additional nitrogen or phosphorus added. Three ARGs will be used for this experiment and will be spiked into the samples as eDNA in the form of gBlockTM gene sequences. Persistence will be determined over the course of 4 weeks with 5 sampling points, twice in the first week and once in the weeks thereafter. (4) Determine if increasing sediment concentrations increase or decrease extracellular ARG presence and persistence in reuse water (Task 4 and 5) This task will focus on concentrations of sediment. Sediment used in this experiment will be sterilized silt loam (characterized for texture analysis) soil representing one of the commonly found soil textures of Arkansas soils. Soil samples will be obtained with the help of Discovery Farms or Extension personnel. Soil samples will be sterilized three times in an autoclave with a 2-day wait time between each run. Sediment concentrations will be chosen that bracket 1.0 - 100.0 mg/L, which are those commonly found in surface water across Arkansas from January, 2020 to July, 2022. This experiment will follow a similar protocol as the first experiment in Task 2.

Impacts
What was accomplished under these goals? Tested the developed protocols for quantifying extra- and intra-cellular ARGs with QPCR using synthetic samples In the previous report, we developed a protocol for distinguishing and quantifying extra- and intra-cellular ARGs with QPCR. As a follow up, we vigorously tested the developed protocol using synthetic samples. The synthetic samples were made up by mixing plasmids with E. coli bacteria at different ratios. Both the plasmids and the bacteria carried the CmR (chloramphenicol resistance) gene. The synthetic samples then went through the developed protocol (i.e., centrifugation, wash, and filtration) and were separated into extra-cellular (EC) samples and intra-cellular (IC) samples. The EC and IC samples were then used for QPCR measurements. We observed that the measured concentration of extra- and intra-cellular CmR genes correlated very well with the concentration of plasmids and bacteria, respectively. In the log-log plots, the measured concentrations of CmR gene were almost linear to the ground-true values, for both extra-cellular and intra-cellular CmR gene. These results showed the success of the developed method and the achievement of the goal of Task 1. Applied the developed protocols for quantifying extra- and intra-cellular ARGs in water samples We further applied the developed protocols for quantifying extra- and intra-cellular ARGs in water samples. The water samples were collected from Lake Fayetteville (Site 1 of Task 2). The water samples were first concentrated by 40 times, followed by the developed protocols for QPCR measurements of ARGs. We tested 7 ARGs: ermF, vanA, sul1, sul2, mecA, tetO, and tetA, Extra-cellular vanA and tetO were positive, while intra-cellular ermF and vanA were positive. Negative results were obtained for extra-cellular ermF, mecA, and tetA, and intra-cellular mecA, tetO, and tetA. Results for sul1 and sul2 were problematic, as the negative control without the water samples showed positive QPCR results, indicating that the primers for these two genes (obtained from published literature) may need to be improved. Tested the FISH protocol for intra-cellular ARG quantification in synthetic samples The designed library of FISH probes were fluorescently labeled with Quasar 570 dyes, and used for label the CmR genes in synthetic samples (i.e., containing E. coli bacteria with or without the CmR gene). Briefly, the intra-cellular samples were fixed by formaldehyde and permeabilized by ethanol. After heating the microbes to 95°C for 5 min, the library of fluorescent FISH probes were added to the samples, followed by slow cooling to room temperature over 12 hours. After thorough wash, the intra-cellular samples were imaged with a fluorescence microscope. We observed that the bacteria carrying the CmR gene showed ~60% higher intensity in the fluorescence than the bacteria without the CmR gene, indicating that the FISH protocol worked to some extent, while optimization may be needed for applications to water samples. Investigated the navigation of bacteria in soil-like porous media The motion of bacteria in soil and sediments is a significant factor for determining the fate of intra-cellular ARGs (part of Task 4 and 5). In the past year, we investigated the motion of bacteria in synthetic soil-like porous media using E. coli bacteria as a model system. The soil-like porous media were made of microspheres of 6 μm, and the motion of E. coli bacteria were monitored using fluorescence microscopy. Compared to bacteria in aqueous solution, we observed that the bacteria slowed down significantly as the density of microspheres increased. For example, at the highest density of microspheres used in the study, the average bacterial velocity was only 40% of that in aqueous solution. In addition, we found that the bacteria exhibited larger and more frequent directional changes as the density of microspheres increased. Such changes happened mostly around the microspheres and due to the collisions with the microspheres. More importantly, we established and quantified the correlation between the bacterial trapping in the soil-like porous media and the geometric confinement imposed by the microspheres. In addition, numerical simulations showed that the active Brownian motion model in the presence of microspheres resulted in bacterial motion that are consistent with the experimental observations. Our study suggested that it is important to distinguish the ability of bacteria to move easily - bacterial mobility - from the ability of bacteria to move independently - bacteria motility. Our results showed that bacterial motility remains similar in soil-like porous media, but bacterial mobility was significantly affected by the pore-scale confinement. Prepared groundwork for soil-ARG experiments (Task 3 and 5) Soil and water samples from two locations in Northwest AR were collected on March 9, 2022. The first location was a farm that produces broiler poultry and beef. The focus for sample collections was the soil around and the waters within a pond containing runoff from the chicken production area. The second location was a beef and sheep with rotational grazing practices. Two ponds were sampled on this property. One pond was fenced off and had limited access for livestock. Water was pumped out to watering stations in the field. The other pond was an open pond were livestock had ingress and egress access. The second farm was sampled again for soil and water on August 25, 2022 to further the work on completing objective 1. TaqMan primer and probes were designed using the PrimerQuestTM tool on the Integrated DNA Technologies website, targeting 7 antimicrobial resistance genes. Sulfonamide resistance is represented by sul1 and sul2 resistance genes, macrolides by the ermF resistance gene, tetracycline by the tet(A) and tet(O) resistance genes, glycopeptide resistance by the vanA resistance gene, and methicillin resistance by the mecA gene. Thermal conditions were determined experimentally to optimize PCR outcomes for each primer/probe pair. Primers for six antimicrobial resistance genes were optimized with similar thermal conditions and were therefore considered to be used further. The primers for vanA, however, were not shown to be effective at similar thermal conditions to the other six genes, so cannot be used in multiplex studies with the other six assays. DNA template used for optimization was gBlockTM gene fragments of target antimicrobial resistance gene (ARG) sequences ordered from Integrated DNA technologies. Each primer/probe assay was evaluated and optimized for multiplex qPCR using gBolckTM gene fragments and environmental samples. Two groups of ARG gene target sequences were used, sul1, sul2, and ermF, having FAM, HEX, and Cy5 fluorophore tags respectively, and tetA, tetO, and mecA, with Fem, Hex and Cy5 fluorophore tags respectively. Sample collected from advanced reuse treatment plant (Task 4) We collaborated with the Norman Water Reclamation Facility (Norman, OK) on the pilot testing of advanced reuse treatment. The pilot plant includes a new Ozone-BAC treatment process, and a consecutive UV-AOP process built in February 2022 by Xylem, USA. The domestic sewage undergoes the biological treatment and filtration before entering the pilot facility. It first goes through the Oxelia trailer with ozone and two biologically activated carbon (BAC) media filters, then into the MiPRO trailer for UV-AOP treatment, where UV dosage was always above 100 mJ/cm2 in conjunction with peroxide. During pilot operation, influent for the trailers was switched weekly, to study the effect of the filter types on the downstream advanced treatment processes. For this study, only the batch reactor process was sampled, and ozone dosage was adjusted from 6.3, 14, 12, and 10 ppm during the sampling period. The samples were subjected to total DNA extraction, intra- and extra-DNA separation and will be analyzed for 7 selected ARGs.

Publications

  • Type: Journal Articles Status: Submitted Year Published: 2022 Citation: Diksha Shrestha, Jun Ou, Ariel Rogers, Amani Jereb, Yong Wang. Bacterial mobility and motility in porous media mimicked by microspheres. Submitted to Colloids and Surfaces B: Biointerfaces (available on BioRxiv), 2022.


Progress 12/01/20 to 11/30/21

Outputs
Target Audience:Stakeholders including the scientific community, agricultural community, policy makers and the public. Changes/Problems:Tasks have been delayed for the following reasons. 1) The boarding of the two Ph.D. students was delayed due to COVID-19. One arrived in January 2021 and the other started in August 2021. 2) Partly due to COVID-19, the procurement system at UA and approval chain have been somewhat broken and causing significant delays. 3) Supplies of certain materials and supplies (e.g., 0.22 µm filters, DNA extraction kits) have been problematic and causing significant delays. What opportunities for training and professional development has the project provided?This project has provided opportunities for training and professional development for one M.S. student (Ms. Celestene Sebag) under the supervision of PI Dr. Zhang, one Ph.D. student (Ms. Amani Jereb) in the laboratory of Co-PI Dr. Wang, and one Ph.D. student under Dr. Savin. All three students were trained in the areas of bacterial growth, gel electrophoresis, plasmid extraction, conventional and quantitative polymerase chain reaction (PCR and qPCR); Amani was also trained on fluorescence microscopy, fluorescence in situ hybridization (FISH), super-resolution fluorescence imaging, single-particle tracking, and computational skills for quantitative analysis of the experimental results using MATLAB and Python. How have the results been disseminated to communities of interest? Nothing Reported What do you plan to do during the next reporting period to accomplish the goals?1) Continue to establish methodologies based on FISH as proposed in Task 1. 2) Cross-verify qPCR and FISH results. 3) Apply the protocol developed to different intra- and extracellular ARGs in multiple water sources (Task 2). 4) Set up RSSCTs and run depth-filtration with collected reuse water. 5) Run membrane filtration with collected reuse water. 6) Optimize protocol for elution of eDNA from colloids. 7) Determine ARG concentration from collected sediment samples.

Impacts
What was accomplished under these goals? This project will provide critical information on the management of antibiotic resistance genes in agricultural reuse practice. The following aspects have been accomplished during this period. 1) Developed protocols for differentiating and quantifying extra- and intra-cellular ARGs using qPCR In the past 10 months, we developed protocols for differentiating and quantifying extra- and intra-cellular ARGs based on qPCR, which is the goal of Task 1. For this task, we exploited samples of known bacteria and ARGs for the test and verification on how the protocols worked. This verification system was constructed based on an E. coli wild-type strain (MG1655) and a plasmid (pHNS::mEos3.2::CmR, CmR=Chloramphenicol Resistance). Several samples were made: (S-B) MG1655 bacteria only, (S-G) pHNS::mEos3.2::CmR plasmids only , (S-BEG) MG1655 bacteria mixed with pHNS::mEos3.2::CmR plasmids, (S-BIG) MG1655 bacteria transformed with pHNS::mEos3.2::CmR plasmids, (S-BEIG) MG1655 bacteria transformed with pHNS::mEos3.2::CmR plasmids and then mixed with additional pHNS::mEos3.2::CmR plasmids. Sample S-B serves as a negative control, while Sample S-G was used for generating qPCR standard curves. Sample S-BEG contains bacteria and extracellular ARGs (i.e., CmR), S-BIG contains bacteria and intracellular ARGs, and S-BEIG contains bacteria and both extra- and intra-cellular ARGs. We generated the qPCR standard curve using extracted and purified plasmids (pHNS::mEos3.2::CmR, i.e., S-G). The purified plasmids were prepared in a 10-fold dilution series, followed by qPCR measurements using a set of primers on an Open qPCR machine (Chai Inc., USA). The threshold cycles (Cq) were determined and plotted against the concentration of CmR gene. We note that the standard curve works over 7 orders of magnitude. We also established and applied protocols for separating extra- and intra-cellular ARGs using both centrifugation and filtration. Briefly, each sample was centrifuged at 5000 rpm for 10 min. The supernatant was collected and filtered with a 0.22 µm filter, producing the extra-cellular sample (ECS). The pellet after centrifuge was washed twice by DI water and resuspended in 1 mL DI water, producing the intra-cellular sample (ICS). The ECS and ICS samples were then used for qPCR measurements. We observed that the established protocols were successful. All the samples containing the ARGs showed Cq values below 30, while those without the ARGs had Cq values above 30. We observed that the sample S-BIG-ECS was at the borderline, presumably due to the possible leakage of intra-cellular ARGs. We believe that the qPCR-based protocols are readily applicable to Task 2 and Task 3 of the project. 2) Designed fluorescent probes for FISH experiments We also designed and ordered fluorescent DNA probes for fluorescent in situ hybridization (FISH) experiments for Task 1. Sequences of 25 probes targeting the CmR gene were designed (Table 1). All the probes were labeled by Quasar 570 dyes at the ends. Table 1. Sequences of designed FISH probes. ccagtgatttttttctccat, gggatatatcaacggtggta, aaatgttctttacgatgcca, agcaactgactgaaatgcct, tgaacggtctggttataggt, acggtctttaaaaaggccgt, gccggataaaacttgtgctt, ggcgggcaagaatgtgaata, aattccggatgagcattcat, accgtctttcattgccatac, ggtgaacactatcccatatc, gtttcagtttgctcatggaa, attcactccagagcgatgaa, aaactgccggaaatcgtcgt, catcttgcgaatatatgtgt, caggttttcaccgtaacacg, ctcaataaaccctttaggga, aactggtgaaactcacccag, ccatattggccacgtttaaa, atggtgaaaacgggggcgaa, gccttgcgtataatatttgc, tgatgaacctgaatcgccag, atggaagccatcacagacgg, attcattaagcattctgccg, cactcatcgcagtactgttg, 3) Determined ARG concentrations from multiple water sources We have established qPCR standard curves for seven ARGs using gBlock gene fragments purchased from IDTDNA. They include sul1 and sul2 (resistant to sulfonamides), ermF (resistant to macrolides), tetA and tetO (resistant to tetracycline), vanA (resistant to glycopeptides), and mecA (resistance to methicillin). In the past 10 months, we took three rounds of samples from different water sources, including (1) wastewater effluent from 2 wastewater treatment plants in Fayetteville and 1 wastewater treatment plants in Springdale, (2) lake water from Beaver Lake and Lake Fayetteville, (3) agriculture pond water from Savoy farm, and (4) irrigation water from rice field trenches in eastern Arkansas. These locations provide a variety of nontraditional sources for irrigation water. Upon arrival at the research lab, the water samples were subjected to direct DNA extraction and filtration. The DNA extracts were analyzed for relative concentration of all seven ARGs using qPCR. All selected ARGs except for mecA and vanA were detected in the first round of water samples. Currently the intra- and extracellular ARGs are not differentiated in this measurement. 4) Prepared filtration setup for ARG treatment. We started acquiring supplies to set up the rapid small-scale column tests (RSSCTs), including activated carbon, glass columns, pressure gauges, pretreatment filters, pumps and accessories, etc. The M.S. student (Celestene) is getting trained on column operation and medium preparation. We expect to complete the RSSCT setup and start running the filtration test soon. 5) Prepared for ARG-soil interaction experiments A PhD student was hired in August 2021 by Co-PI Dr. Savin and has been identifying water bodies in Arkansas for sampling water and sediments. He has been preparing the laboratory with supplies and learning methodologies for sampling and preparing samples for DNA extraction and preparation. He has also been researching different protocols to elute DNA from organic and inorganic colloids.

Publications