Recipient Organization
UNIVERSITY OF GEORGIA
200 D.W. BROOKS DR
ATHENS,GA 30602-5016
Performing Department
CFACS - Foods and Nutrition
Non Technical Summary
NON TECHNICAL SUMMARY:There is an increased interest in the potential health benefits of functional foods. Foods that can promote gut microbiota fermentation may impact not only gastrointestinal health, but also inflammation and obesity-related processes. Indigestible carbohydrates such as fibers but also resistant starch can be fermented by commensal bacteria in the distal gut. Our studies will examine the effect of potato resistant starch supplementation on populations of intestinal bacteria, as well as on biomarkers of gastrointestinal health, systemic inflammation and glucose tolerance, using an animal model of obesity. This will enhance knowledge of the potential for RS to act as prebiotic and improve chronic disease and human health.
Animal Health Component
(N/A)
Research Effort Categories
Basic
100%
Applied
(N/A)
Developmental
(N/A)
Goals / Objectives
Obesity has been characterized as a low grade inflammatory condition; obesity-associated inflammation is believed to originate, at least partially, from the gastrointestinal (GI) tract. In rodent models, high fat (HF) feeding leads to changes in microbiota composition associated with an increase in GI permeability, allowing for translocation of pro-inflammatory bacterial products to the circulation. Subsequent low grade chronic inflammation has been shown to trigger insulin resistance.My laboratory is particularly interested in dietary manipulations that aim to improve microbiota composition and restore gut barrier function. We have previously found in HF fed rodents that an increase in GI short chain fatty acids (SCFAs) production is associated with improved GI integrity, systemic inflammation and insulin signaling. Potato resistant starch (PRS) digestion in the small intestine is limited, and it can reach the large intestine and be fermented by bacteria into SCFAs. Interestingly, in humans, RS consumption improves glucose homeostasis. Therefore, in this project, we propose to investigate the effects of PRS supplementation on 1) microbiota composition, 2) GI functions, 3) inflammatory profile and insulin signaling.OBJECTIVES:1. An increase in SCFA production enhances GI intestinal integrity. 2. A healthy gut barrier can prevent leakage of pro-inflammatory products. 3. A decrease in inflammation is beneficial for insulin function. 4. RS has been shown to promote bacterial fermentation. Therefore, we hypothesize that PRS supplementation will induce compositional changes in the gut microbiota and improve GI function, inflammatory status and insulin signaling.We propose to test this hypothesis in a model of high-fat diet (HFD)-induced inflammatory state. We will feed Wistar rats a control low fat (LF) diet or a HFD. Half of the animals fed a HFD will be supplemented with potato resistant starch (10%, HFRS). Our objectives for this studies are.Determine the effect of PRS supplementation on gut microbiota profileHF feeding leads to marked microbiota dysbiosis, notably an increase in the Firmicutes to Bacteriodetes ratio and proliferation of pro-inflammatory bacteria [1, 2]. We will determine if PRS supplementation can attenuate the effects of HF feeding.Determine the effect of PRS supplementation on GI functionHFD driven microbiota dysbiosis is associated with impairment in gut morphology and an increase in gut permeability, resulting in translocation of pro-inflammatory bacterial products, notably, lipopolysaccharide (LPS) to the circulation[1]. We will determine if PRS supplementation can improve GI epithelial function and prevent LPS translocation.Determine the effect of PRS supplementation on glucose homeostasisPro-inflammatory cytokines have been found to impair insulin signaling by promoting insulin receptor substrate 1 (IRS1) phosphorylation at Ser307, inhibiting its action and contributing to insulin resistance [3]. Additionally, SCFAs enhance glucagon-like peptide 1 (GLP-1) production, a known incretin. We will determine the effects of PRS supplementation on insulin signaling and glucose tolerance.Positive results from our study will support the establishment of PRS as a potent prebiotic with potential therapeutic benefits against obesity-associated comorbidities
Project Methods
METHODSDetermine the effect of PRS supplementation on gut microbiota profileAnimals and Diets. Twenty-four male Wistar rats (200-220g) will be ordered from Envigo Indianapolis, IN) and single-housed in a temperature-controlled room with a 12 hrs light-dark cycle. Following one week of habituation, animals will be divided into three groups (n=8/group) and fed a regular control LF diet (10% kcal from fat), HF (45% kcal from fat) or a HFD supplemented with 10% PRS (HFRS) for 8 weeks. Six weeks of HF feeding (45%) has previously been found to be sufficient to induce microbiota dysbiosis and systemic inflammation in rats [13]. Group size was determined by power calculation. Diets will be custom-made by Research Diets (New Brunswick, NJ); all diets will have the same fiber content, and HF and HFRS diets will be isocaloric. The corn starch and maltodextrin in the HFD formulation (D12541) will be replaced by raw, unmodified potato starch in the HFRS diet (Bob's Red Mill, Milwaukie, OR) which contains about 50% RS2 by weight [21] (Table 1). The level of RS supplementation (10%) is based on previously published data [8]. Raw potato starch, rich in RS2, significantly increases SCFA production in the large intestine when compared to other sources of potato starch [8]. After 8 weeks on their respective diets, animals will be sacrificed, and serum, liver, gut and adipose tissues will be collected, snap frozen and stored at -80°C.Microbiota analysis. Fecal pellets will be collected at baseline, and fecal and cecal samples will be collected after 8 weeks on respective diets. Bacterial DNA will be extracted from fecal and cecal contents (Zymo Research fecal DNA kit), and high throughput sequencing will be performed with Illumina MiSeq paired-end 250 base-pair runs on the V4 region of the 16S rRNA genes.METAGENassist and Galaxy platforms will be used for data processing and analysis. Phylogenic abundances will be normalized by log transformation, and differences among groups will be assessed by ANOVA. Multivariate analysis will be conducted to identify taxonomic features discriminating of one or more groups.SCFA quantification: Acetate, butyrate and propionate will be quantified in serum and cecal samples via gas chromatography mass spectrometry at the MayoDetermine the effect of PRS supplementation on GI functionGI morphology and goblet cell proliferation: GI tissues (ileum and colon) will be cryosectioned (5μm; Leica CM1900, Leica Biosystems, Wetzlar, Germany). Sections will be stained with Alcian blue and nuclear fast red (Sigma-Aldrich, Saint Louis, MO). Villus height (μm) and the number of goblet cells (per crypt) will be measured manually in well-oriented sections (5 measurements per ileal section) using a light microscope (BX40, Olympus) equipped with a digital camera (DP25, Olympus) and analysis software (DP2-BSW, Olympus).Real-time quantitative PCR (RT-PCR): mRNA will be extracted from ileum tissues using the RNeasy Mini Kit (qiagen, Valencia, CA) and assessed for quantity and purity using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE). cDNAs will be synthesized using the RevertAid™ First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Franklin, MA). RT-PCR will be done on a StepOnePlus real-time PCR system (Thermo Fisher Scientific) using SYBR Green PCR master mix (Thermo Fisher Scientific) and GLP-1 and Muc2 primers purchased from Integrated DNA Technologies (Table 2). Data will be analyzed according to the 2-ΔΔCt method [22].LPS assay: LPS will be measured in serum using a pyrochrome lysate mix, a quantitative chromogenic reagent, diluted in Glucashield buffer which inhibits cross-reactivity with (1 → 3)- β-D-Glucans (Associates of Cape Cod, East Falmouth, MA). Samples will be diluted 1:10 in pyrogen-free water (Associates of Cape Cod) and heated for 10 min at 700C. Samples and reactive solution will be incubated at 370C for 30 min, and absorbance will be read at 405 nm.GeneForward primers (5' to 3')Reverse primers (5' to 3')β actinACGGTCAGGTCATCACTATCGATGCCACAGGATTCCATACGAPDHGAGCATCTCCCTCACAATTCGGGTGCAGCGAACTTTATGlp-1CCAAGCAAGGAGAGAGAAACGATGACCAAGGCAGAGAAAGIl-1bCGTCTGCCCTATCAACTTTCGATGTGGTAGCCGTTTCTCIl-6TGTTGTGGGTGGTATCCTCCTTCTTGGGACTGATGTTGMuc2CTGAGGAAGGCCAAGTTTACCAGGTCCCAGAGAGGAAATATnfaTCTACTCCCAGGTTCTCTTCGCTGACTTTCTCCTGGTATGTable 2: Primer sequences for RT-PCR. b actin and GAPDH (glyceraldehyde 3-phosphatedehydrogenase) are control genes.Determine the effect of PRS supplementation on glucose homeostasisOral glucose tolerance test (OGTT): After 7 weeks on respective diets, animals will be fasted for 5 h before oral gavage with a glucose solution (2 g/kg body weight using 20% glucose, Sigma-Aldrich). Glycemia will be measured using a glucometer (Freestyle, Alameda, CA) before (0 min) and after (15, 30, 60, 90, and 120 min) glucose administration. Blood samples (~100 μL) will be collected at each time point for insulinemia and GLP-1 analysis. Blood samples will be treated with dipeptidyl peptidase-IV (DPP-IV) inhibitor (10µL/mL, EMD Millipore, Billerica, MA) to prevent GLP-1 degradation. GLP-1 and insulin levels will be measured in serum by ELISA (GLP-1: Millipore; Insulin: Alpco, Salem, NH).RT-PCR: The same procedures described in Specific Aim 2 will be conducted on mesenteric (visceral) adipose tissues to measure expression of the pro-inflammatory cytokines TNF-α, IL-1β and IL-6. Primer sequences can be found in Table 2; mRNA from adipose tissue will be extracted using the RNeasy Lipid Tissue Mini Kit (qiagen).Western Blot: Liver proteins will be extracted using lysis buffer (Life Technologies, Carlsbad, CA), and protease and phosphatase inhibitors (Roche Diagnostics, Indianapolis, IN). Twenty μg of protein will be loaded on precast Bolt 10% Bis-Tris mini gels (Life Technologies, Carlsbad, CA) for separation before being transferred to a PVDF membrane and probed with primary antibodies (1:1000; Cell Signaling Technology, Beverly, MA) to GAPDH (loading control), IRS1and phospo-IRS1 Ser307. Anti-Rabbit IgG and anti-biotin HRP conjugated secondary antibodies (Cell Signaling Technology) will then be applied to the membranes. Licor WesternSure chemiluminescent substrate will be used as a detection agent, and blots will be quantified using a C-DiGit Blot Scanner and Image Studio software (LiCor, Lincoln, NE).Power analysis. Power analysis using previous data from our group has shown that an n of 6 per group is sufficient to observe marked differences in microbiota composition after 4 weeks of HFD (Table 3, using Firmicutes/Bacteriodetes ratio, 2 tailed, p<0.05; power 90%); therefore, we are confident that a n of 8 per group is sufficient to detect significant differences in the measured outcomes.