EXAMINATION OF RISK FACTORS ASSOCIATED WITH CALCIUM OXALATE KIDNEY STONE DISEASE ON GOATS

• Sponsoring Institution: National Institute of Food and Agriculture
• Project Status: COMPLETE
• Funding Source: ANIMAL HEALTH
• Reporting Frequency: Annual
• Accession No.: 1005899
• Project Start Date: Feb 19, 2015
• Project End Date: Jan 31, 2020
• Program Code: [(N/A)]- (N/A)

Recipient Organization
UNIVERSITY OF FLORIDA
G022 MCCARTY HALL
GAINESVILLE,FL 32611

Performing Department
College of Veterinary Medicine

Non Technical Summary
The goat industry in the US has grown significantly in the past decade. The high demand in goats is attributed to several emerging factors, specifically demographic shift by immigration from countries with high goat consumption. Other attributing factors are household companion, dairy production, entertainment, and biotechnology. To sustain a robust and healthy livestock, it is pertinent that we provide adequate and critical care for them. One of the most frequent urinary diseases associated in goats is obstructive urolithiasis or the inability to void urine due to stone formation in the kidneys. The stones are made up of calcium phosphate, magnesium ammonium phosphate, or calcium oxalate. One of the major causes of urolithiasis in goats is oxalate toxicity resulting from consuming plants with high quantities of potassium and sodium oxalate. Furthermore, oxalic acid is a common by-product of liver metabolism and its production adds to the overall burden of oxalic acid. The goals of the proposed studies are to examine blood and urine oxalate levels in goats with urolithiasis using our newly developed oxalate test strips, and to determine beneficial bacteria in gut that could degrade oxalate. The results of the proposed studies are expected to provide critical information concerning the presence of oxalate, gut beneficial bacteria and their potential association with development and onset of calcium oxalate kidney stone disease in goats. It is anticipated that the overall results will impact the goat industry through maintaining healthier animals and lowering medical expenditures.

Animal Health Component

60%

Research Effort Categories

Basic

20%

Applied

60%

Developmental

20%

Classification

Knowledge Area (KA)	Subject of Investigation (SOI)	Field of Science (FOS)	Percent
311	3820	1010	100%

Knowledge Area
311 - Animal Diseases;

Subject Of Investigation
3820 - Goats, meat, and mohair;

Field Of Science
1010 - Nutrition and metabolism;

Keywords

goat

oxalate

urolithiasis

kidney stone disease

microbiome

oxalobacter formingenes

Goals / Objectives
Specific Aim 1. Establish a normal reference range for oxalate in goats (normal healthy goats in North Central Florida).Specific Aim 2. Examine blood and urine oxalate levels in goats affected by urolithiasis.Specific Aim 3. Carry out global microbiome and qPCR studies to determine changes in the gut microflora of goats presenting with urolithiasis, focusing specifically on the presence or absence of O. formigenes.

Project Methods
Experimental ApproachesSpecific Aim 1. Establish a normal reference range for oxalate in goats (normal healthy goats in North Central Florida).Oxalate levels are affected by nutritional diets, physiology, and geographical areas. Species and breed of goats could have different and significant impact on oxalate metabolism. Currently, there is a lack of data regarding the normal and inherent levels of oxalate in healthy goats in the US or specifically North Central Florida. As a result, it is imperative that we establish a normal reference range based on species, breed, and geographic area. UF Veterinary Hospital sees a large number of goat patients from the state of Florida with a majority from North Central Florida. Healthy patients (n=200) will divided into groups based on dietary feeds, breeds, and geographical locations. Fresh samples of venous blood (5 ml per animal in lavender top blood collection tubes containing EDTA purchased from BD Biosciences) and urine (5 ml per animal in sterile urine specimen collection cup from BD Sciences) will be collected. One drop of whole blood or one drop of urine will be placed on an oxalate strip. The oxalate strips are developed by our laboratory containing oxalate oxidase enzyme41. The strips will be submerged in a solution containing hydrogen peroxide and 3-(Dimethylamino) benzoic acid to produce a blue color compound. Blue color strips will be inserted in an OneTouch Ultra 2 meter (LifeScan, Inc, CA, USA) to measure the oxalate concentration in milligram per deciliter (mg/dL). The results from this specific aim will provide a conclusive normal reference for oxalate in goats based on feeds, breeds, and geographical areas.Specific Aim 2. Examining the levels of oxalate in blood and urine of goats affected by urolithiasis.As indicated in Specific aim 1, measuring oxalate in blood and urine of healthy goats will provide a clear normal standard concentration that we could use to base subsequent analysis on. In this specific aim, our goal is to determine the levels of oxalate in blood and urine of goats affected by urolithiasis. Using our patented a proprietary technology on producing and using oxalate test strips which can be read by commercial glucometer41, fresh samples of venous blood and urine (5 ml of blood per animal in lavender top blood collection tubes containing EDTA and 5 ml of urine per animal in sterile urine specimen collection cup) will be collected from affected goats (n=80, approximately 20 goats with urolithiasis per year) that are seen in clinics at the UF Veterinary Hospital. One drop of whole blood or one drop of urine will be placed on an oxalate strip and inserted in an OneTouch Ultra 2 meter (LifeScan, Inc, CA, USA). Results from goats with urolithiasis will be compared to healthy normal standard identified in specific aim 1 to determine whether oxalate levels are normal, high, or low. Furthermore, the results will be correlated with normal human range, which is approximately 0.11-0.46 mmol or 9.7-40.5 mg.Specific Aim 3. Using global microbiome and qPCR studies to determine changes in the gut microflora of goats presenting with urolithiasis, focusing heavily on the presence or absence of O. formigenes. To study the possible correlation of O. formigenes in urolithiasis of goats, studies will first be carried out identifying the global intestinal microbiome on fecal specimens from goats presenting in clinics, followed by QC-PCR specific for O. formigenes. Microbiome studies: Fecal specimens collected from each goat will be prepared for deep sequencing. Briefly, bacterial DNA will be isolated directly from fresh stool samples obtained from individual goats using the recommended manufacturer's procedures (QIAamp DNA Stool Mini Kit, Qiagen, CA, USA). In brief, Approximately 200 mg of feces will be thoroughly suspended in 1.4 ml of lysis buffer and heated for 5 min at 700C. Samples will be vortexed and centrifuged at 16,000 × g for 1 min. Samples will be centrifuged at 16,000 × g for 3 min. Pellet inhibitors bound to InhibitEX matrix will be discarded. Supernatant will be collected and mixed with 15 μl of proteinase K to digest proteins. Ethanol will be added to precipitate bacterial DNA. Suspension will be added to spin column containing silica membrane binding to DNA. Loaded spin column will be centrifuged at 16,000 × g for 1 min. The column will be washed twice with buffer by centrifugation. Bacterial DNA will be eluded from column using 200 μl of Elution buffer provided in the kit by centrifugation at 16,000 × g for 1 min. DNA concentration and purity will be measured using Nanodrop 2000 (Thermo Scientific, DE, USA) with an expected A260/A280 ratio at 1.7-1.9 range. Isolated DNA will be used as template in polyermase chain reactions (PCR) targeting the V1-V5 variable regions of the 16S rRNA gene. Samples will be run using HiSeq sequencing apparatus, available in UF's ICBR. These data are extremely relevant, highlighting the functional significance of dysbiotic alterations in the structured compositions of the bacterial community in the guts (both mouth and intestine) of the goats. The primary bacterial groups to be followed will be normalized to Eubacteria, the classical housekeeper group.Quantitative-PCR studies: Quantitative-PCRs (QC-PCRs) will be performed as described elsewhere19,30,42. In brief, 50-μl reaction mixtures contained 1.5 mM MgCl2, 200 μM deoxynucleoside triphosphate, 1.25 U of Taq (Life Technologies, CA, USA), 1 μg of bacterial DNA, and 1 μM concentrations (each) of 5′-ACACACGGATCCATGAGTAACGACGACAATGT and 3'ATATATGGATCCAAAAAGAA TGTTCTCGTGGC. The optimal reaction profile is 94°C for 5 min followed by 35 cycles of 94°C for 1 min for denaturation, 60°C for 1 s with a gradual decrease of 0.1°C/S to 55°C for annealing, and 72°C for 1 min for primer extension. For QC-PCR, 1 μl of an appropriate dilution of competitive templates will be added to the standard PCR mixture. PCR and QC-PCR products will be size separated by gel electrophoresis in 1.2% agarose containing ethidium bromide, illuminated with UV light, and photographed for documentation. Gels will then scanned using ChemiDoc XRS imaging system (BioRad, CA, USA) to determine the relative band intensities of the PCR products for quantification.

Progress 02/19/15 to 01/31/20

Outputs
Target Audience: Nothing Reported Changes/Problems: Nothing Reported What opportunities for training and professional development has the project provided?There were a number of undergraduate students, postdoctoral fellows, and veterinary residents who were involved in the projects. The students and postdocs were trained to measure oxalate using commercial kits and our custom-made oxalate kits. They were trained to perform qPCR for fecal bacteria. Veterinary residents were trained to recruit patients, perform blood work, chemistry tests, urinary analysis, and stone analysis. The whole team learned to present data at a professional meeting and writing manuscripts. How have the results been disseminated to communities of interest?Poster presentation at Phi Zeta Celebration Annual Research Day and manuscript submission. What do you plan to do during the next reporting period to accomplish the goals? Nothing Reported

Impacts
What was accomplished under these goals? Specific Aim 1. Establish a normal reference range for oxalate in goats (normal healthy goats in North Central Florida). To achieve this specific aim, our research plan was to recruit healthy patients (n=200) and divided into groups based on dietary feeds, breeds, and geographical locations. Fresh venous blood and urine would be collected. Oxalate levels would be measured using our custom-made oxalate strips in the lab. Due to the logistics and costs of transporting and seeing patients at the clinics, we have recruited 20 healthy controls. We have collected blood, urine, and fecal samples from these subjects Specific Aim 2. Examine blood and urine oxalate levels in goats affected by urolithiasis. To achieve this specific aim, we proposed to measure blood and urinary oxalate using our patented a proprietary technology. We proposed to collect 80 urolith-affected goats based on the previous hospital visits by clients. Unfortunately, due to the logistics of transporting and high costs for standard of care (blood work, chemistry test, urinary analysis, and stone analysis), we have recruited 9 patients with urolithiasis. We have performed complete blood work, chemistry tests, urinary analysis, stone analysis, and oxalate test. Specific Aim 3. Carry out global microbiome and qPCR studies to determine changes in the gut microflora of goats presenting with urolithiasis, focusing specifically on the presence or absence of O. formigenes. To achieve this specific aim, we proposed to carry out the identification of the global intestinal microbiome on fecal specimens from goats presenting in clinics, followed by QC-PCR specific for O. formigenes. We have collected fecal samples from all the subjects. We have extracted RNAs from the samples.

Publications

• Type: Conference Papers and Presentations Status: Published Year Published: 2017 Citation: An innovative method for rapid detection of spot urinary oxalate in goats with urolithiasis. Arun Wanchoo PhD, Demia de Tonnerre BVSc, Elizabeth Nelson, BVSc, Jim Burrow, Samuel Tao, Robert J. MacKay, BVSc, PhD, DACVIM, PhD Sarah M. Reuss VMD, Cuong Q. Nguyen PhD. Phi Zeta 2017
• Type: Journal Articles Status: Submitted Year Published: 2020 Citation: An innovative method for rapid detection of urinary oxalate in goats with urolithiasis Tina Esfandiary, Patel T. Suraj, Arun Wanchoo PhD, Alexandria Voigt, Demia de Tonnerre BVSc, Elizabeth Nelson, BVSc, JA Burrow, Samuel Tao, Robert J. MacKay, BVSc, PhD, DACVIM, PhD Sarah M. Reuss VMD, Cuong Q. Nguyen PhD.
• Type: Journal Articles Status: Awaiting Publication Year Published: 2020 Citation: Association of Oxalobacter Formingenes and clinical symptoms in goats with urolithiasis. Tina Esfandiary, Patel T. Suraj, Alexandria Voigt, Sarah M. Reuss VMD, Cuong Q. Nguyen PhD.

Progress 10/01/18 to 09/30/19

Outputs
Target Audience: Nothing Reported Changes/Problems: Nothing Reported What opportunities for training and professional development has the project provided? Nothing Reported How have the results been disseminated to communities of interest? Nothing Reported What do you plan to do during the next reporting period to accomplish the goals? Nothing Reported

Impacts
What was accomplished under these goals? For this reporting period, we addressed the objective in specific aim 3. We have determined that goats with urolthiasis have lower levels of O. formigenes in their fecals samples in comparison to non-urolthiasis goats.

Publications

Progress 10/01/17 to 09/30/18

Outputs
Target Audience:The Project will have significant interests of broad target audiences, specifically: 1. Goat farmers who raise, manage, and provide daily care. 2. Goat consumers who need to know the quality of meat, milk, and hide. 3. Clinicians or veterinarians who provide diagnosis and treatment related to urinary system diseases. Changes/Problems:We have encountered difficulty in achieving our patient recruitment goal as proposed. However, we will continue our effort of recruiting more patients for the study. We will also redo the power analysis to identify the optimal sample size in order to obtain statistical meaningful data. What opportunities for training and professional development has the project provided? Nothing Reported How have the results been disseminated to communities of interest?Poster presentation at Phi Zeta Celebration Annual Research Day What do you plan to do during the next reporting period to accomplish the goals?We are planning to complete the analysis and submit at least two research manuscripts to report our finding. In addition, we are in the process of performing the microbiome studies to complete the last aim of this project.

Impacts
What was accomplished under these goals? Specific Aim 1. Establish a normal reference range for oxalate in goats (normal healthy goats in North Central Florida). To achieve this specific aim, our research plan was to recruit healthy patients (n=200) and divided into groups based on dietary feeds, breeds, and geographical locations. Fresh venous blood and urine would be collected. Oxalate levels would be measured using our custom-made oxalate strips in the lab. Due to the logistics and costs of transporting and seeing patients at the clinics, we have recruited 20 healthy controls. We have collected blood, urine, and fecal samples from these subjects. We have performed complete blood work, chemistry tests, urinary analysis, stone analysis, and oxalate test. We have completed the analysis. The data were presented at Phi Zeta Celebration Annual Research Day (April 13-14, 2017). We are in the process of writing a manuscript for this work. Specific Aim 2. Examine blood and urine oxalate levels in goats affected by urolithiasis. To achieve this specific aim, we proposed to measure blood and urinary oxalate using our patented a proprietary technology. We proposed to collect 80 urolith-affected goats based on the previous hospital visits by clients. Unfortunately, due to the logistics of transporting and high costs for standard of care (blood work, chemistry test, urinary analysis, and stone analysis), we have recruited 9 patients with urolithiasis. We have performed complete blood work, chemistry tests, urinary analysis, stone analysis, and oxalate test. We have completed the analysis. The data were presented at Phi Zeta Celebration Annual Research Day (April 13-14, 2017). We are writing a manuscript to report the finding of this specific aim with specific aim 1. Specific Aim 3. Carry out global microbiome and qPCR studies to determine changes in the gut microflora of goats presenting with urolithiasis, focusing specifically on the presence or absence of O. formigenes. To achieve this specific aim, we proposed to carry out the identification of the global intestinal microbiome on fecal specimens from goats presenting in clinics, followed by QC-PCR specific for O. formigenes. We have collected fecal samples from all the subjects. We have extracted RNAs from the samples. We are initiating the microbiome studies and quantitative-PCR experiments. Overall, then, considerable progress has been accomplished. We have encountered difficulty in achieving our patient recruitment goal. However, we will continue our effort of recruiting more patients for the study. We anticipate to complete specific aim 3 within the next two years.

Publications

Progress 10/01/16 to 09/30/17

Outputs
Target Audience:The Project will have significant interests of broad target audiences, specifically: 1. Goat farmers who raise, manage, and provide daily care. 2. Goat consumers who need to know the quality of meat, milk, and hide. 3. Clinicians or veterinarians who provide diagnosis and treatment related to urinary system diseases. 4. Policy makers or governing bodies who need to conduct epidemiological and etiological studies for population and environmental impacts on health. Changes/Problems:We have encountered difficulty in achieving our patient recruitment goal as proposed. However, we will continue our effort of recruiting more patients for the study. We will also redo the power analysis to identify the optimal sample size in order to obtain statistical meaningful data. What opportunities for training and professional development has the project provided? Nothing Reported How have the results been disseminated to communities of interest?Poster presentation at Phi Zeta Celebration Annual Research Day What do you plan to do during the next reporting period to accomplish the goals?We are planning to complete the analysis and submit at least two research manuscripts to report our finding. In addition, we are in the process of performing the microbiome studies to complete the last aim of this project.

Impacts
What was accomplished under these goals? EXPERIMENTAL PROGRESS Specific Aim 1. Establish a normal reference range for oxalate in goats (normal healthy goats in North Central Florida). To achieve this specific aim, our research plan was to recruit healthy patients (n=200) and divided into groups based on dietary feeds, breeds, and geographical locations. Fresh venous blood and urine would be collected. Oxalate levels would be measured using our custom-made oxalate strips in the lab. Due to the logistics and costs of transporting and seeing patients at the clinics, we have recruited 20 healthy controls. We have collected blood, urine, and fecal samples from these subjects. We have performed complete blood work, chemistry tests, urinary analysis, stone analysis, and oxalate test. We have completed the analysis. The data were presented at Phi Zeta Celebration Annual Research Day (April 13-14, 2017). We are in the process of writing a manuscript for this work. Specific Aim 2. Examine blood and urine oxalate levels in goats affected by urolithiasis. To achieve this specific aim, we proposed to measure blood and urinary oxalate using our patented a proprietary technology. We proposed to collect 80 urolith-affected goats based on the previous hospital visits by clients. Unfortunately, due to the logistics of transporting and high costs for standard of care (blood work, chemistry test, urinary analysis, and stone analysis), we have recruited 9 patients with urolithiasis. We have performed complete blood work, chemistry tests, urinary analysis, stone analysis, and oxalate test. We have completed the analysis. The data were presented at Phi Zeta Celebration Annual Research Day (April 13-14, 2017). We are writing a manuscript to report the finding of this specific aim with specific aim 1. Specific Aim 3. Carry out global microbiome and qPCR studies to determine changes in the gut microflora of goats presenting with urolithiasis, focusing specifically on the presence or absence of O. formigenes. To achieve this specific aim, we proposed to carry out the identification of the global intestinal microbiome on fecal specimens from goats presenting in clinics, followed by QC-PCR specific for O. formigenes. We have collected fecal samples from all the subjects. We have extracted RNAs from the samples. We are initiating the microbiome studies and quantitative-PCR experiments. Overall, then, considerable progress has been accomplished. We have encountered difficulty in achieving our patient recruitment goal. However, we will continue our effort of recruiting more patients for the study. We anticipate to complete specific aim 3 within the next two years.

Publications

Progress 10/01/15 to 09/30/16

Outputs
Target Audience:The Project will have significant interests of broad target audiences, specifically: 1. Goat farmers who raise, manage, and provide daily care. 2. Goat consumers who need to know the quality of meat, milk, and hide. 3. Clinicians or veterinarians who provide diagnosis and treatment related to urinary system diseases. 4. Policy makers or governing bodies who need to conduct epidemiological and etiological studies for population and environmental impacts on health. Changes/Problems: Nothing Reported What opportunities for training and professional development has the project provided? Nothing Reported How have the results been disseminated to communities of interest?The results were presented at a meeting that was opened to the public. What do you plan to do during the next reporting period to accomplish the goals? Nothing Reported

Impacts
What was accomplished under these goals? Specific Aim 1. Establish a normal reference range for oxalate in goats (normal healthy goats in North Central Florida). To achieve this specific aim, our research plan was to recruit healthy patients (n=200) and divided into groups based on dietary feeds, breeds, and geographical locations. Fresh venous blood and urine would be collected. Oxalate levels would be measured using our custom-made oxalate strips in the lab. Due to the logistics and costs of transporting and seeing patients at the clinics, we have recruited 20 healthy controls. We have collected blood, urine, and fecal samples from these subjects. We have performed complete blood work, chemistry tests, urinary analysis, stone analysis, and oxalate test. We have completed the analysis. The data were presented at Phi Zeta Celebration Annual Research Day (April 13-14, 2017). We are in the process of writing a manuscript for this work. Specific Aim 2. Examine blood and urine oxalate levels in goats affected by urolithiasis. To achieve this specific aim, we proposed to measure blood and urinary oxalate using our patented a proprietary technology. We proposed to collect 80 urolith-affected goats based on the previous hospital visits by clients. Unfortunately, due to the logistics of transporting and high costs for standard of care (blood work, chemistry test, urinary analysis, and stone analysis), we have recruited 9 patients with urolithiasis. We have performed complete blood work, chemistry tests, urinary analysis, stone analysis, and oxalate test. We have completed the analysis. The data were presented at Phi Zeta Celebration Annual Research Day (April 13-14, 2017). We are writing a manuscript to report the finding of this specific aim with specific aim 1. Specific Aim 3. Carry out global microbiome and qPCR studies to determine changes in the gut microflora of goats presenting with urolithiasis, focusing specifically on the presence or absence of O. formigenes. To achieve this specific aim, we proposed to carry out the identification of the global intestinal microbiome on fecal specimens from goats presenting in clinics, followed by QC-PCR specific for O. formigenes. We have collected fecal samples from all the subjects. We have extracted RNAs from the samples. We are initiating the microbiome studies and quantitative-PCR experiments. Overall, then, considerable progress has been accomplished. We have encountered difficulty in achieving our patient recruitment goal. However, we will continue our effort of recruiting more patients for the study. We anticipate to complete specific aim 3 within the next two years.

Publications

• Type: Conference Papers and Presentations Status: Published Year Published: 2017 Citation: Phi Zeta Celebration Annual Research Day

Progress 02/19/15 to 09/30/15

Outputs
Target Audience: Nothing Reported Changes/Problems:As indicated, due to the difficulty of transporting patients to the hospital and the high cost for the standard of care, we have not achieved our recruitment goal. With possible additional funding, we will continue to recruit more patients. However, based on the recent experience, we will never reach the recuitment goal during the span of this project. What opportunities for training and professional development has the project provided? Nothing Reported How have the results been disseminated to communities of interest? Nothing Reported What do you plan to do during the next reporting period to accomplish the goals?We will continue our effort of recruiting patients for the study. We will complete the data analysis and write up a research manuscript for specific aims 1 and 2. In order to achieve the goals set for specific aim 3, we have started to perform the microbiome and PCR experiments.

Impacts
What was accomplished under these goals? Specific Aim 1. Establish a normal reference range for oxalate in goats (normal healthy goats in North Central Florida). To achieve this specific aim, our research plan was to recruit healthy patients (n=200) and divided into groups based on dietary feeds, breeds, and geographical locations. Fresh venous blood and urine would be collected. Oxalate levels would be measured using our custom-made oxalate strips in the lab. Due to the logistics and costs of transporting and seeing patients at the clinics, we have recruited 20 healthy controls. We have collected blood, urine, and fecal samples from these subjects. We have performed complete blood work, chemistry tests, urinary analysis, stone analysis, and oxalate test. We are in the process of analyzing the data. We anticipate to complete the analysis within 3 months. Specific Aim 2. Examine blood and urine oxalate levels in goats affected by urolithiasis. To achieve this specific aim, we proposed to measure blood and urinary oxalate using our patented a proprietary technology. We proposed to collect 80 urolith-affected goats based on the previous hospital visits by clients. Unfortunately, due to the logistics of transporting and high costs for standard of care (blood work, chemistry test, urinary analysis, and stone analysis), we have recruited 9 patients with urolithiasis. We have performed complete blood work, chemistry tests, urinary analysis, stone analysis, and oxalate test. We are in the process of analyzing the data. We anticipate to complete the analysis within 3 months. A manuscript will be written to report the finding of this specific aim with specific aim 1. Specific Aim 3. Carry out global microbiome and qPCR studies to determine changes in the gut microflora of goats presenting with urolithiasis, focusing specifically on the presence or absence of O. formigenes. To achieve this specific aim, we proposed to carry out the identification of the global intestinal microbiome on fecal specimens from goats presenting in clinics, followed by QC-PCR specific for O. formigenes. We have collected fecal samples from all the subjects. We have extracted RNAs from the samples. We are in the process of performing the microbiome studies and quantitative-PCR experiment. Overall, then, considerable progress has been accomplished. We have encountered difficulty in achieving our patient recruitment goal. However, we will continue our effort of recruiting more patients for the study. We anticipate to complete specific aim 3 within the next two years

Publications