COMPLEMENTATION OF A FUR DELETION MUTANT OF MYCOBACTERIUM PARATUBERCULOSIS

• Sponsoring Institution: State Agricultural Experiment Station
• Project Status: COMPLETE
• Funding Source: STATE
• Reporting Frequency: Annual
• Accession No.: 1003598
• Project Start Date: Jul 10, 2014
• Project End Date: Mar 19, 2015
• Program Code: [(N/A)]- (N/A)

Recipient Organization
UNIV OF MINNESOTA
(N/A)
ST PAUL,MN 55108

Performing Department
Veterinary Population Medicine

Non Technical Summary
Johne's disease (JD) is a chronic enteric infection of dairy cattle worldwide and imposes significant economic losses to the industry. Mycobacterium avium subsp. paratuberculosis (MAP), the causative agent of JD, requires a supplementation of a iron scavenging molecule for optimal growth in laboratory media. This unique iron requirement contributes to MAP's slow growth, often requiring eight to sixteen weeks to produce colonies in culture - a major hurdle in the diagnosis and therefore in implementation of optimal JD controls measures. We have discovered a new regulatory element in MAP that may help us to identify alternate mechnism by which this organism thrives in the host or the environment. Our findings are likely to aid in development of newer and faster diagnostics for MAP infection in cattle.

Animal Health Component

20%

Research Effort Categories

Basic

75%

Applied

20%

Developmental

5%

Classification

Knowledge Area (KA)	Subject of Investigation (SOI)	Field of Science (FOS)	Percent
311	3499	1040	100%

Knowledge Area
311 - Animal Diseases;

Subject Of Investigation
3499 - Dairy cattle, general/other;

Field Of Science
1040 - Molecular biology;

Keywords

fur

iron

mycobacterium avium paratuberculosis

johne's disease

Goals / Objectives
Johne's disease (JD) is a chronic enteric infection of dairy cattle worldwide and imposes significant economic losses to the industry. Mycobacterium avium subsp. paratuberculosis (MAP), the causative agent of JD, requires a siderophore (mycobactin) supplementation for optimal growth in laboratory media. This unique iron requirement contributes to MAP's slow growth, often requiring eight to sixteen weeks to produce colonies in culture - a major hurdle in the diagnosis and therefore in implementation of optimal JD controls measures.A significant gap in knowledge is the comprehensive understanding of the mechanisms by which MAP regulates intracellular iron under a variety of environmental conditions, which is key for both devising more effective culture methods as well as interfering with its ability to cause disease. Others and we have shown that MAP can survive in culture media with iron metabolites alternate to mycobactin.We have discovered ferric uptake regulator (fur) on a genomic island unique to MAP. We propose that fur is biologically active and serves as an alternater iron regulator to IdeR in MAP. Our objective is to create a deletion and complementation strain for the fur locus to enable interrogation of its role in MAP physiology and survival.

Project Methods
Mutant library generation and identification of MAP 3773c knockdown strain: A stock of the ΦMycoMarT7 transposon obtained from David Sherman, Seattle Biomedical Research Institute was used in creating a mutant library of MAP. This 2kb DNA sequence is capable of replicating and producing infective phages (sometimes called phasmids) in Mycobacteria at 30°C, but not at 37°C. The phage was propagated in Mycobacteria according to the protocol of Murry et al., (56). 5000transformants have been screened and a insertional muntant in MAP73776c (a gene upstream of fur) has been identified, confirmed and shown to knowdown transcription of fur.Complementation of 3773c knock down.We will apply pSM417 (a plasmid with a cloning site driven by an hsp60 promotor) to clone 3776c and transform the mutant of MAP. We have performed these types of studies with ideR complemntation succesfully. Complemented strains will be studied for restoration of both transcriptiion and phenotype regeneration. Future studies will involve establishment of fur function in MAP.

Progress 07/10/14 to 03/19/15

Outputs
Target Audience: Nothing Reported Changes/Problems: Nothing Reported What opportunities for training and professional development has the project provided? Fernanda Miyagaki, a graduate student trained on this project to perform basic cloning, transcription analysis and complementation studies. How have the results been disseminated to communities of interest? Nothing Reported What do you plan to do during the next reporting period to accomplish the goals? Nothing Reported

Impacts
What was accomplished under these goals? Since the sequence of MAP3776c is known, it was possible to design primers for PCR amplification of the gene directly from Mycobacterium paratuberculosis strain K10 genomic DNA. PCR was carried out by standard molecular techniques. Briefly, 25ng MAPK10 genomic DNA, HotStarTaq Master Mix (Qiagen), 20 pmoles each primer (F: GTGAACCTGATCGCCAAGAT, R: CTCGGTCTGCGTGTTGTAGA). Amplification was for 35 cycles of PCR. The length of the product was determined by electrophoresis on an agarose gel. The product contained a single band of the desired length. After the desired product has been verified by agarose gel and DNA sequencing analysis, we proceeded for cloning and transformation. Mycobacterium smegmatis mc2155 with psM417 (plasmid) was subculture in LBKan50 to extract plasmid. Double digest of MAP3776c and psM417 was done using enzymes Pst-1 HF and BamHI-HF. Using Quick ligation protocol (New England BioLabs), psM417 was ligated to MAP3776c. Used chemically competent Top10 E.coli cells (Invitrogen) for cloning of psM417-MAP3776c. Transformation into mycobacterium was done by electroporation using Mycobacterium smegmatis mc2155 (fast grow mycobacterium). On day 4 after plating, selected colonies were tested positive by PCR and DNA sequencing analysis for the presence of the MAP3776c. Sequencing was performed by BMGC at the University of Minnesota and confirmed using Sequencher software. For the complementation assay, Tn.:3776c was subculture in 100ml of MB7H9 containing 50ug/ml of kanamycin for 6 weeks. 50ml of cells were harvested and used for electroporation. The assay was performed plating 3 different conditions: cells+psM417; cells + psM417+MAP3776c; cells+water. After 6 weeks, colonies were tested by PCR, we were able to confirm the complete restoration of fur transcription in the mutant. Thus a fur complement has been created successfully.

Publications