Progress 12/01/00 to 03/14/04
Outputs
Studies indicated that high phenolic spearmint clonal lines from greenhouse system grown clonal lines isolated during this USDA-NRI proposal investigation had high anti-H.pylori activity. The high anti-H.pylori activity is associated with high protocatechuic acid clonal lines. Protocatechuic acid is absent in all commercial sources and commercial sources have much lower antimicrobial against H. pylori and also lower antioxidant activity. We have continued to characterize the phenolic profiles of various spearmint clonal lines for antioxidant and antimicrobial activity against H. pylori. We have further extended screening to more suitable relatives of spearmint such as lemon balm (Melissa officinalis) that has more potent phenolics and higher rosmarinic acid. Lemon balm like spearmint is excellent for beverage systems and could be a better source of antimicrobials. We have also found clonal lines of oregano (Origanum vulgare) that have potent anti-microbial activity
against H. pylori and we will evaluate the efficacy and compared to commercial sources (Chun et al., 2005). However, when comparing the 3 Lamiaceae species on a dry weight and phenolic basis we have found that spearmint clonal lines had higher inhibitory activity than oregano and oregano higher than lemon balm. This work would now provide the basis to test spearmint extracts in a beverage system against H. pylori (Lin et al., 2005). Polymerase chain reaction (PCR) was used to identify various clonal lines of spearmint, lemon balm and oregano. The results indicated that there was close relationship and differences between seed sources of different origin. It also confirmed that clonal lines from one seed source is variable and can be separated by PCR finger printing methods using consensus tRNA primers. A particular PCR finger-print for a specific clonal line was also maintained over subculture cycles in tissue culture and therefore could be used for monitoring clonal specificity.
Impacts
Dietary herbs such as spearmint and other related species such as oregano, thyme and lemon balm in the family Lamiaceae are good sources of phenolic antioxidants and antimicrobials. Tissue culture-based methods offer strategies to develop clonal phenolic profiles that are consistent for antioxidant and antimicrobial functionality. Specific clonal lines of spearmint and oregano indicated potential for inhibition of ulcer bacteria and both water and ethanol soluble extracts could be isolated for food or beverage- based delivery. This offers an additional potential for dietary management of ulcer infections linked to Helicobacter pylori. Since such infections affect over 50% of the global population and higher percentage among the elderly, dietary complimentary approaches can compliment current therapies such as use of multiple antibiotics and proton-pump inhibitor combinations, which have side effects and potential for antibiotic resistance. Another added advantage of
dietary phenolic antioxidant from clonal herbs developed in this proposal is the potential for enhancing host antioxidant enzyme response, which has implications for chemoprevention of several oxidation-linked diseases.
Publications
- Chun, S-S., Vattem, D.A., Lin, Y-T. and Shetty, K. (2005) Phenolic antioxidants from clonal oregano (Origanum vulgare) with antimicrobial activity against Helicobacter pylori. Process Biochemistry, 40: 809-816.
- Lin, Y-T., Vatttem, D.A., Labbe, R.G. and Shetty, K. (2005) Enhancement of antioxidant activity and inhibition of Helicobacter pylori by phenolic phytochemical enriched alcoholic beverages. Process Biochemistry, 40: 2059-2065.
|
Progress 12/01/00 to 11/30/03
Outputs
Several high rosmarinic acid and high phenolic spearmint clonal lines were isolated from single seed origin using tissue culture methods during this USDA-NRI project. Further studies indicated that same high phenolic spearmint clonal lines from greenhouse system grown clonal lines had high anti-H.pylori activity. The high anti-H.pylori activity is associated with high protocatechuic acid and high rosmarnic acid clonal lines. We have further extended tissue culture screening to more suitable relatives of spearmint such as lemon balm (Melissa officinalis) that have more potent phenolics and higher rosmarinic acid. Lemon balm like spearmint is excellent for beverage systems and could be a better source of antimicrobials. We have also isolated clonal lines of oregano (Origanum vulgare) that have potent anti-microbial activity against H. pylori. However, when comparing the 3 Lamiaceae species on a dry weight and phenolic basis we have found that spearmint clonal lines had
higher inhibitory activity than oregano and oregano higher than lemon balm. This work would now provide the basis to test spearmint extracts in a beverage system and oregano in a meat delivery system against H. pylori. It was challenging to isolate high phenolic clonal lines of spearmint that were inhibitory against urinary tract-linked Escherichia coli. Todate we have isolated just one clonal line that is moderately inhibitory. However, the E.coli inhibition by spearmint clonal extract could be enhanced when combined with cranberry extracts enriched with more soluble phenolics. Polymerase Chain Reaction (PCR) was used to identify various clonal lines of spearmint, lemon balm and oregano. Two methods were used in our studies. In the first method a pair of consensus tRNA gene primers facing outward from the tRNA genes were used to amplify DNA. The PCR fingerprints developed from these primers are mainly derived from regions between closely linked tRNA. Genomic fingerprints are largely
conserved within species and any small variation should help classification of clonal lines in highly cross-pollinating species like Lamiaceae, including Spearmint targeted in this proposal. Two tRNA primers will be used: P#1: 5'AGTCCGTGCTCTAACCAAC3' & P#2: 5'GGGGGTTCGAATTCCCGCCGGC3' . This method developed through this proposal has been successful for several lines of spearmint, lemon balm and oregano. The results indicated that there was close relationship and differences between seed sources of different origin. It also confirmed that clonal lines from one seed source is variable and can be separated by PCR finger printing methods using consensus tRNA primers. A particular PCR finger-print for a specific clonal line was also maintained over subculture cycles in tissue culture and therefore could be used for monitoring clonal specificity.
Impacts
Dietary herbs such as spearmint and other species such as oregano, thyme and lemon balm in the family Lamiaceae are good sources of phenolic antioxidants and antimicrobials. Tissue culture-based methods offer strategies to develop clonal phenolic profiles that are consistent for antioxidant and antimicrobial functionality. Our results indicate that phenolics from consistent clonal herbs can be beneficial to counter infections from ulcer-bacteria, Helicobacter pylori. The infections from H.pylori affect close to 50% of the world population and about 10% of this population may have severe infections leading to peptic ulcer and gastric cancer, if untreated. Current therapies for H.pylori, such as antibiotics and proton-pump inhibitors though effective, have side-effects and there is evidence of antibiotic resistance. Therefore, a dietary management of H.pylori using phenolic phytochemicals has potential both in terms of inhibiting the bacterial pathogen as well as
enhancing host antioxidant response to counter the pathogen.
Publications
- Chun, S-S., Vattem, D.A., Lin, Y-T. and Shetty, K. (2004) Phenolic antioxidants from clonal oregano (Origanum vulgare) with antimicrobial activity against Helicobacter pylori. Process Biochemistry, Accepted for Publication.
|
Progress 10/01/02 to 09/30/03
Outputs
We have further evaluated the antoxidant and antimicrobial efficacy of several spearmint clonal lines. We have isolated over 10 clonal lines with high phenolic antioxidants that can inhibit Helicobacter pylori in disk and broth assays using tissue culture-based phenolic extracts as well as extracts of clonal plants from such tissue cultures grown in greenhouse and field. No new clonal line of spearmint was effective against E.coli and we have preliminary evidence that phenolic-linked cellular acidification of E.coli by spearmint phenolic extracts can be countered and this may be linked to proline-linked antioxidant response pathway. This may be the case in most acid-tolerant bacteria such as E.coli and Salmonella. In case of H.pylori we have developed a novel plate assay to screen for clonal spearmint phenolic extracts that can inhibit the pathogenesis-related urease that the bacteria uses to counter low pH. This screening plate assay has been used to evaluate
H.pylori inhibiting extracts from other herb clonal systems such as oregano and lemon balm as well as legumes such as soybean and fenugreek. We are also studying phenolic synergies to counter H.pylori and its urease using fruit and Lamiaceae phenolic combinations.
Impacts
Dietary herbs such as spearmint and other species such as oregano, thyme and lemon balm in the family Lamiaceae are good sources of phenolic antioxidants and antimicrobials. Tissue culture-based methods offer strategies to develop clonal phenolic profiles that are consistent for antioxidant and antimicrobial functionality. Our results indicate that phenolics from consistent clonal herbs can be beneficial to counter infections from ulcer-bacteria, Helicobacter pylori. The infections from H.pylori affect close to 50% of the world population and about 10% of this population may have severe infections leading to peptic ulcer and gastric cancer, if untreated. Current therapies for H.pylori, such as antibiotics and proton-pump inhibitors though effective, have side-effects and there is evidence of antibiotic resistance. Therefore, a dietary management of H.pylori using phenolic phytochemicals has potential both in terms of inhibiting the bacterial pathogen as well as
enhancing host antioxidant response to counter the pathogen.
Publications
- Vattem, D.A., Lin, Y-T., Ghaedian, R. and Shetty, K. (2003) Antimicrobial activity against Listeria monocytogenes and Helicobacter pylori by phenolic antioxidant enriched juice and pomace extracts of cranberry (Vaccinum macrocarpon). Submitted to Innovative Food Science and Emerging Technologies.
|
Progress 10/01/01 to 09/30/02
Outputs
Several high phenolic spearmint clonal lines were developed and among these 5 clonal lines had high phenolic antioxidant activity and moderate antimicrobial activity against ulcer-causing Helicobacter pylori in disk assays. Only one of these clonal lines had a moderate antimicrobial activity against urinary tract infect causing E.coli. We are continuing our efforts to screen more spearmint clonal lines and have extended this investigation to high phenolic-producing oregano clonal lines. The results using oregano clonal lines are excellent. Over 10 of the 25 high phenolics-producing clonal lines that have high antioxidant activity strongly inhibited H.pylori in disk assays. We have selected one antimicrobial postive clonal line and generated ethanol and water extracts from various development stages of field grown clonal plants and tested the efficacy against H.pylori inhibition in disk and broth assays. A range of 100-200 microgram phenolics/ml is sufficient to
inhibit H.pylori. We have compared the high phenolic clonal line to many commercial sources of oregano and found that the clonal line was highly superior in efficacy against H.pylori. The high phenolic clonal had significant levels of rosmarinic acid, quercetin and protocatechuic acid as indicated by HPLC and these phenolics may have contributed to the antimicorbial activity. We are now extending the use of these clonal extracts from oregano to study inhibition of urinary tract infection-linked E.coli and this is proving to be more challenging than H.pylori.
Impacts
Food-grade herbs from the Lamiaceae family are excellent sources of phenolic antioxidants and antimicrobials. The use of such herbs for health benefit through potential functional foods cannot be achieved due to inconsistency of phytochemicals as a result of high degree of heterogeneity in species in this family. High phenolics-producing clonal lines have allowed the development of food-grade extracts that are clearly inhibitory to ulcer-causing Helicobacter pylori. The infections of H.pylori in the long-term can lead to gastric cancer and as a result this organism that is found in 50% of world population, is designated as a Class 1 carcinogen by World Health Organization. The use of high phenolic clonal herbs such as spearmint and oregano through the diet as functional food could help to manage the infections from H.pylori before they cause chronic problems. The clonal herb phenolics could be targeted not just against H.pylori but the antioxidant function of
phenolics could also contribute to host response and protection.
Publications
- Chun, S-S., Vattem, D.A., Lin, Y-T. and Shetty, K. (2003) Phenolic antioxidant activity and inhibition of Helicobacter pylori activity by clonal extracts of Origanum extracts. In preparation: Food Biotechnology.
|
Progress 10/01/00 to 09/30/01
Outputs
Over 50 high phenolic clonal lines of spearmint, each from a different heterozygous seed origin have been isolated. These high phenolic clonal lines were isolated based on a screening method that selected the lines that were tolerant to a non-pathogenic Pseudomonas sp. From these, 5 clonal lines, 4 high phenolic and 1 medium phenolic line and all with high rosmarinic acid were evaluated for antioxidant and antimicrobial activity.The high phenolic containing lines had a total phenolic content of around 25-27 mg/gram dry weight and the medium phenolic line had a content of 15-17 mg/gram after 45 days of shoot culture under in vitro conditions. The rosmarinic acid content of all 5 lines were in the range of 1.5-2.0 % of dry weight. These contents translated to very high antioxidant activity based on inhibition of DDPH (1,1-diphenyl-2-picrylhydrazyl radical). The % inhibition was in the range of 89-91% for all clonal lines. The antioxidant activity based on oxidation of
beta-carotene, however was high only in the 4 high phenolic clonal lines. This indicated that other components in the phenolic profile contributed to the antioxidant activity. We are now comparing antioxidant activity between very high rosmarinic acid clonal lines in very high phenolic (25 mg/gram) and very low phenolic (10 mg/gram) clonal lines. In terms of antimicrobial activity , the high phenolic clonal lines were inhibitory to Helicobacter pylori in disk assays and Listeria monocytogenes in broth assays. The efficacy against Escherichia coli is being tested.
Impacts
Development of clonal lines of spearmint with consistent and high phenolic conents has potential for developing natrual foods with therapeutic phytochemicals that have both antioxidant and antimicrobial properties. These have implications for managing oxidation-linked diseases such as arthritis and cardio vascular as well as cognition-related health and wellness problems through the diet. The non-GMO screening methods for developing superior antioxidant and antimicrobial clonal lines will help to develop food-grade herbs that are GRAS (generally regarded as safe).
Publications
- Randhir, R., Sharma, M. and Shetty, K. (2001) Phenolic antioxidant activity in spearmint clonal lines is correlated to high phenolic content but not high rosmarinic acid. Food Biotechnology, In preparation.
- Tong, L. and Shetty, K. (2001) High phenolic clonal lines of spearmint and antimicrobial activity against Helicobacter pylori and Listeria monocytogenes, J. Agric. Food Chem., In preparation.
|
|