Source: NANOHMICS INC submitted to
AN APTAMER-QUANTUM DOT-BASED LATERAL FLOW TEST STRIP FOR CYCLOSPORA DETECTION
Sponsoring Institution
National Institute of Food and Agriculture
Project Status
COMPLETE
Funding Source
SMALL BUSINESS GRANT
Reporting Frequency
Annual
Accession No.
1027208
Grant No.
2021-33610-35666
Cumulative Award Amt.
$649,998.00
Proposal No.
2021-06416
Multistate No.
(N/A)
Project Start Date
Sep 1, 2021
Project End Date
Feb 29, 2024
Grant Year
2021
Program Code
[8.5]- Food Science & Nutrition
Project Director
Bruno, J. G.
Recipient Organization
NANOHMICS INC
6201 E OLTORF ST STE 400
AUSTIN,TX 787417509
Performing Department
Biotechnology
Non Technical Summary
Phase II Project Summary/Abstract The lateral flow (LF) or immunochromatographic test strip is a staple test format in the food safety testing tool kit for its speed and ease of use in the field. However, the sensitivity of LF assays is limited partly due to some lower antibody affinities and partly due to the visual detection limit of colloidal gold or colored latex particles. Cyclospora catagenesis is an important emerging waterborne and foodborne pathogenic parasite that causes prolonged watery diarrhea and requires very sensitive detection due to low infective doses. There is a sensitive PCR-based confirmatory test available for Cyclospora developed by the FDA already. However, the Cyclospora PCR test and related clinical Cyclospora tests including modified Acid Fast staining of stool or tissue samples require significant sample preparation (formalin-ethyl acetate treatment and centrifugation to pre-concentrate oocysts) which prolongs detection and is confined to central laboratories. The PCR test cannot be used in the field or food processing plants at present, yet there is an immediate need and economic driver to bring fresh produce from Mexico and Central America (where Cyclospora is more prevalent) into the food supply chain for North America. Thus, there is an urgent need for rapid field testing of large volumes of agricultural irrigation water and produce swabs or rinsates to limit the spread of Cyclospora or try to virtually eliminate it from the entire North American continent's food supply. Therefore, Nanohmics Inc. proposes to develop DNA aptamer (higher affinity surrogates for antibodies)-based fluorescent quantum dot (Qdot) LF test strips for Cyclospora oocysts or their extracts for rapid presumptive screening of irrigation water and/or fresh produce swabs/rinsates in the field or fresh produce packing and processing plants. Nanohmics proposes to achieve the highest possible sensitivity in a rapid (< 15 minute) field test which can be assessed by red Qdot-aptamer conjugate tags on oocysts by visible or sensor-detected visible fluorescence versus green Cyclospora oocyst autofluorescence with a simple handheld UV mineral light or handheld fluorescence sensor. There is a previous USDA SBIR Phase II-funded precedent for this technology which the proposed PI (Dr. Bruno), completed and published for foodborne pathogenic bacteria in the open access journal Pathogens 3:341-355, 2014 and several other journals. In addition, Nanohmics will develop a 5 micron membrane filter or ultrafiltration fiber-based sample preparation protocol (from the standard BAM method) to capture, back flush and concentrate the 8-10 micron Cyclospora oocysts from large volumes (10-100 liters) of irrigation water or fresh produce rinsates prior to filter fluorescence microscopy assessment or fluorescent LF strip testing. The broader impacts of this SBIR project resulting from Phase II development and productization/commercialization of the system will include enhanced food and water safety for the public to more rapidly and sensitively detect Cyclospora and other parasites or food and waterborne bacterial and viral pathogens as well as better on-site decision making ability for food processing and packing facilities. These facilities could use Nanohmics' proposed test strips to easily and safely decide if foods can be sold or should be tested further and possibly sanitized with peroxyacetic acid or discarded. In addition, aptamer-based fluorescent LF test strips can be developed to detect a broad array of clinical, veterinary, environmental pollutant, and other analytes. Initially, food producers will be Nanohmics' main customers. However, the customer base could expand dramatically as Nanohmics moves fluorescent aptamer-LF test strip technology into the homeland security and clinical arenas to detect a wide array of toxic analytes.
Animal Health Component
40%
Research Effort Categories
Basic
10%
Applied
40%
Developmental
50%
Classification

Knowledge Area (KA)Subject of Investigation (SOI)Field of Science (FOS)Percent
71274102020100%
Knowledge Area
712 - Protect Food from Contamination by Pathogenic Microorganisms, Parasites, and Naturally Occurring Toxins;

Subject Of Investigation
7410 - General technology;

Field Of Science
2020 - Engineering;
Goals / Objectives
Phase II Technical Objectives (TOs): TO-1 Identify extant DNA aptamer sequences from Phase I aptamer pools or develop new DNA aptamers that clearly bind the outer cell wall surface of unsporulated Cyclospora cayetanensis oocysts, since the current aptamers appear to stain spores inside sporulated oocysts, but perhaps also the cell wall surface. Some current aptamers may also detect unsporulated oocysts upon further screening, but if not, Nanohmics will develop whole oocyst aptamers to bind the outer cell wall. Note: the paucity of available oocysts from the CDC in Phase I, limited Nanaohmics' ability to screen aptamers for oocyst surface staining by fluorescence microscopy.TO-2 Fully develop lateral flow (LF) aptamer-quantum dot (Qdot) test strips and assess their limits of detection (LODs) for sporulated and unsporulated Cyclospora cayetanensis oocysts.TO-3 Develop a large-scale aptamer-fluorescence filter test and determine its LOD for Cyclospora oocysts from 10-50 or more liters of water.TO-4 Compare, downselect and build a prototype LF test strip fluorescence reader or automated fluorescence microscope for large volume filters.TO-5 Interface with agricultural business leaders (e.g., Conagra, Xgenex, etc.) and LARTA to develop a licensing agreement or other business/commercialization strategy.TO-6 Submit quarterly and/or annual and final technical reports as required or desired by USDA NIFA.
Project Methods
Major methods technology development will include:- SELEX DNA aptamer development which is probably finished considering Phase I data, but may be revisited, if necessary, in Phase II to generate more aptamers to bind Cyclospora oocyst cell walls.- Fluorescence detection especially of red Qdots with long Stoke's shifts (UV excitation to > 650 nm emissions).- Lateral flow test strip technology especially to select the optimal conjugate pads, analytical nictocellulose membranes, wicking times, buffers, etc.- Engineering of a handheld lateral flow test strip fluorescence reader for qualitative and/or quantitative fluorescence assessment.- Engineering of large volume (10-100 liter) water filtration leading to 5 micron pore-sized oocyst filter capture and microscopic analysis.

Progress 09/01/21 to 02/29/24

Outputs
Target Audience:The target audience included other scientists especially parasitologists and food safety scientists at the USDA, CDC and elsewhere. Presentations were made to the Cyclospora Task Force headed by Dr. Alex daSilva of the USDA on May 28, 2024 and the key results were published here:Bruno J.G., Sivils J. Natarajan M. DNA Aptamer-Based Staining and Fluorescence Microscopy for Rapid Detection of Cyclospora cayetanensis Oocysts. J. Fluorescence. 2023 Dec 18. doi: 10.1007/s10895-023-03533-4. PMID: 38109032.In addition, personnel from Ancera Inc., Eurofins, the Center for Produce Safety and Taylor Farms have been briefed on the results of this Phase II project with the hope of striking a business deal of some sort via Nanohmics' business consultant James Byron of Xgenex. Changes/Problems:The only major change was abandoning of the lateral flow format in favor of more sensitive aptamer-quantum dot fluorescence staining of Cyclospora cyatanensis oocysts on filters and detecting them within minutes using Nanohmics prototype field-portable microscope. Nanohmics' prototypemicroscope resembled the one developed in the following publication: Oyibo P., et al.Schistoscope: An Automated Microscope with Artificial Intelligence for Detection of Schistosoma haematobium Eggs in Resource-Limited Settings. Micromachines 2022, 13, 643. https:// doi.org/10.3390/mi13050643. What opportunities for training and professional development has the project provided?Several lab technicians at Nanohmics and the Univ. of Texas Health Sciences Center in San Antonio (UTHSCSA) were trained in aspects of SELEX aptamer development, immunofluorescence staining, confocal fluorescence microscopy and image analysis including pattern recognition algorithms for Cyclospora oocyst discrimination at Nanohmcis. How have the results been disseminated to communities of interest?Results were disseminated via the 2023 J. Fluorescence peer-reviewed publication as well as Dr. Bruno's presentation to the Cyclospora Task Force and James Byron's briefings to interested industry representatives at the Center for Produce Safety, Eurofins, Ancera, Taylor Farms, etc. What do you plan to do during the next reporting period to accomplish the goals?While the project has officially ended, Nanohmics and James Byron continue to engage interested agricultural industry parties.

Impacts
What was accomplished under these goals? The top aptamer DNA sequences were narrow to 4 sequences against the TA4-likeantigen, Wall Protein (WP)-2 and whole cell/oocysts (WC) by ELISA-like titration assays reported in the J. Fluorescence 2023 paper. These were then used in extensive cross-reactivity studies by confocal fluorescence microscopy reported in the 72 page supplemental file published with the J. Fluorescence article to prove aptamer specificity. A prototype field-portable microscope to find and detect Cyclsopora on 5 um pore size filters within minutes after aptamer-fluorophore (quantum dot) staining, washing and image analysis was also built and tested. Nanohmics proved that while lateral flow aptamer-quantum dot test strips were feasible, they could never be as sensitive as the field microscope with its theoretical limit of detection of one Cyclospora oocyst. The project led to briefings of the new technology to Ancera, Eurofins, Taylor Farms, the USDA's Cyclospora Task Force including Drs. Alex daSilva, Ben Rosenthal and Mark Jenkins.

Publications

  • Type: Journal Articles Status: Published Year Published: 2023 Citation: 2. Bruno J.G., Sivils J. Natarajan M. DNA Aptamer-Based Staining and Fluorescence Microscopy for Rapid Detection of Cyclospora cayetanensis Oocysts. J. Fluorescence. 2023 Dec 18. doi: 10.1007/s10895-023-03533-4. PMID: 38109032


Progress 09/01/22 to 08/31/23

Outputs
Target Audience:The target audience includes scientists working in environmental protection, food safety, and all food producers especially in the fresh produce industry. Changes/Problems: Nothing Reported What opportunities for training and professional development has the project provided?In addition to training of one optical scientist and two engineers in 3D CAD design and construction of the new semi-automated fluorescence microscope including 3D printed parts, even the PI (Dr. Bruno) has been learning new levels ofparasitology by aquiring and testing a variety of non-Cyclospora waterborne parasites from commercial sources, the CDC, FDA and USDA for cross-reactivity of the top aptamer DNA sequences. How have the results been disseminated to communities of interest?Yes,Nanohmics is using publications, trade shows and word of mouth to communicate the progress on this Phase II project to the broader community. Eventually, its website and Xgenex's website will probably be used to disseminate the information further. What do you plan to do during the next reporting period to accomplish the goals?Finalize publication of the aptamer staining results in the Journal of Fluorescence, sign the commercial consulting deal with Mr. Byron at Xgenex and begin promotion of the technology to the business and scientific communities.

Impacts
What was accomplished under these goals? Essntially, TOs 1-4 are completed at this point, but a no cost extension was granted through29 Feb 2024 to enable full completion of TO4 and to allow enactment of aconsulting and businessagreement with Xgenex Inc. to promote the combined aptamer-fluorophore staining and filter-based semi-automated fluorescence microscopicdetection of as few as one Cyclospora cayetanensis oocysttechnology to large companies for partnership, licensing or acquisition.

Publications

  • Type: Journal Articles Status: Submitted Year Published: 2023 Citation: Bruno J.G., Sivils J. Natarajan M. DNA Aptamer-Based Staining and Fluorescence Microscopy for Rapid Detection of Cyclospora cayetanensis Oocysts. J. Fluorescence. Submitted 2023.


Progress 09/01/21 to 08/31/22

Outputs
Target Audience:The target audience includes scientists working in environmental protection, food safety, and all food producers especially in the fresh produce industry. Changes/Problems: Nothing Reported What opportunities for training and professional development has the project provided?In addition to training of one optical scientist and two engineers in 3D CAD design and construction of the new semi-automated fluorescence microscopeincluding 3D printed parts, even the PI (Dr. Bruno) has been learning new levels of parasitology by aquiring and testing a variety of non-Cyclospora parasites for cross-reactivity testing from other companies, the CDC and USDA sources. How have the results been disseminated to communities of interest?Nanohmics is using publications and word of mouth to communicate the progress on this Phase II project to the broader community. Eventually, its website and Xgenex's website will probably be used to disseminae the information further. What do you plan to do during the next reporting period to accomplish the goals?1. Complete cross-reactivity testing of the top 8 Phase I aptamers and top 2 whole oocyst aptamers form Phase iI versus Cyclospora cayetanensis, Cryptosporidium, Emeriae, Amoeba, Giardia and other parasites by confocal fluorescence microscopy and enzyme-linked aptamer assays. 2. Complete and test the semi-automated autofocus filter-based epifluorescence microscope prototype and test it with red, green and blue 8 um fluorescent beads from Bangs Laboratories as well as real Cyclospora oocysts and other parasites. 3. Publish the results of 1 and 2 above. 4. Begin marketing or licensing of the system via information from LARTA or via Xgenex.com. 5. Write and submit the Phase II final report.

Impacts
What was accomplished under these goals? TO-1: The top 8 aptamer DNA sequences developed against the recombinant TA4-like antigen and Wall Protein 2 of Cyclospora cayetanensis from Phase I were tested for surface binding on C. cayetanensis oocysts obtained from Dr. Michael Arrowood at the CDC by Prof. Mohan Natarajan at the University of Texas Health Science Center in San Antonio and all 8 aptamers exhibited strong oocyst surface binding by confocal fluorescence microscopy as reported in: Bruno J.G. Applications in Which Aptamers Are Needed or Wanted in Diagnostics and Therapeutics. Pharmaceuticals (MDPI; Open Access). 15(6), 693, 2022; https://doi.org/10.3390/ph15060693. New aptamers against whole Cyclospora cayetanensis oocysts were developed during year 1 of Phase II and resulted in numerous new aptamer DNA sequences as listed in Table 1 below. The top two sequences from Table 1 (S3 and S16) are currently being tested by both confocal fluorescence microscopy against Cyclospora, Acanthamoeba, Cryptosporidium, Eimaria spp, Encephalitazoon, Giardia, Nagleria fowleri, etc. obatined from the Native Antigen Co. in the U.K. as well as Waterborne Inc., the CDC and USDA (Dr. Mark Jenkins). Results will be reported in year 2. All aptamer DNA sequences were obtained via Illumina sequencing at Base Pair Inc. Table 1 - Top Aptamer DNA sequences against whole Cyclospora cayetanensis oocysts having > 2 ppm frequency in the final aptamer pool Tag Seq Seq Cluster Seq Cluster Prcnt Seq Cluster Pos fcount ppm S16 CCTGGGAGAAGGGAGCGGATCAGCTACACCCTATAG 1 * 1 727 236.46 S3 ACGCTCACCAGTTGCTATATGAAATTGCCTATGGCC 2 * 1 223 72.53 S157 TAAAGTAGAGGCTGTTCTCCAGACGTCGCAGGAGGA x * 1 45 14.64 S200 CCTGGGAGAAGGGAGCGGATCAGCTACACTCTATAG 1 97.22 2 29 9.43 S446 CCTGGGAGAAGGGAGCGGATCAGCTACACCCTACAG 1 97.22 3 27 8.78 S15 CCTGGGAGAAGGGAGCGGATCAGCTACACCCTGTAG 1 97.22 4 16 5.20 S3689 CCCACTTCGTAACAGCAACGAACCTAGATAAGTGCT x * 1 14 4.55 S68 TCTGGGAGAAGGGAGCGGATCAGCTACACCCTATAG 1 97.22 5 13 4.23 S5490 GTCAAAACGTAAGGCATCATTGTCATCGACGTTCCA x * 1 13 4.23 S6452 GGAGATACCACAGGGGGAACATGCCATTGTGCTCTA x * 1 11 3.58 S670 CCTGGGAGAAGGGAGCGGATCAGCTACGCCCTATAG 1 97.22 6 10 3.25 S292 ACCTCACTCTGTGTAGGTCCTGTTATAGAGGTAACG x * 1 10 3.25 S1232 CCCGGGAGAAGGGAGCGGATCAGCTACACCCTATAG 1 97.22 7 9 2.93 S4985 GGTCTCGATGCTACTAATACATAAACAGGAGTGGTA x * 1 9 2.93 S5967 GCAACTGATTGTGTCAATATGGCTTCTACACCGTCC x * 1 9 2.93 S1005 CCTGGGAGAAGGGAGCGGACCAGCTACACCCTATAG 1 97.22 8 8 2.60 S1167 CCTGGGGGAAGGGAGCGGATCAGCTACACCCTATAG 1 97.22 9 8 2.60 S1621 CCGCTCACCAGTTGCTATATGAAATTGCCTATGGCC 2 97.22 2 8 2.60 S945 CCCCCGCAACCTAACGTGGCAGCCATATTATATCAC x * 1 8 2.60 S6722 GCTTCTTCGTTTAACTACTAGACACTCGGACTGTAC x * 1 8 2.60 S182 CGTGGGAGAAGGGAGCGGATCAGCTACACCCTATAG 1 97.22 10 7 2.28 S340 CCTGGGAGGAGGGAGCGGATCAGCTACACCCTATAG 1 97.22 11 7 2.28 S1818 CCTGGGAGAAGGGAACGGATCAGCTACACCCTATAG 1 97.22 12 7 2.28 S2843 GCATTGGTGACCCTCGCGTGGACTACCCAAAGCAGG x * 1 7 2.28 S3923 GCACGGTTTCACTTGAAAAGACGCGGCACAATTCGT x * 1 7 2.28 S5503 ACAATCATTGCAGCGCATTCAGGCATGAACTTACAG x * 1 7 2.28 S6830 CGAGAAGGTTGAAAATCCAAAGAGATCCCTACTGGA x * 1 7 2.28 S6865 GCGATGTAATGTACCCTGCTGATTGGTTCCTACTAG x * 1 7 2.28 TO-2: Nanohmics made a decision to exclusively pursue the semi-automated fluorescence microscope route in Phase II, because despite the extreme sensitivity of quantum dot-based lateral flow test strips, its engineers have been able to show detection of one oocyst or 8 um fluorescent bead surrogate in a matter of one hour or less on a 47 mm diameter filter using microscopy which is a level of sensitivity that quantum dot-lateral flow test strips cannot match. TO-3: Nanohmics continues to work on this TO, by adapting its 47 mm filtration system to the much larger water pre-filtration system for Cyclospora already used by the FDA and described inBAM 19c: Dead-end Ultrafiltration for the Detection of Cyclospora cayetanensis from Agricultural Water. TO-4: Nanohmics now has a working bench top protoype semi-automated epi-fluorescence microscope that it can probably produce for < $1,000 per unitwhich will accomodate and rapidly scan 47 mm diameter low fluorescence carbonate disk filters on which to capture Cyclospora and other parasites from agricultural water concentrates or diluted sewage and fresh produce rinsates. Nanohmics'design resembles the microscope design in the following publication: Oyibo P., et al. Schistoscope: An AutomatedMicroscope with ArtificialIntelligence for Detection ofSchistosoma haematobium Eggs in Resource-Limited Settings.Micromachines 2022, 13, 643. https://doi.org/10.3390/mi13050643 TO-5: Nanohmics continues working with Dr. Calcaterra at LARTA as well as Mr. James Byron at Xgenex to develop the appropriate food safety and food production industry contacts to market the semi-automated microscope and anti-Cyclospora aptamers for staining of the parasites on filters. TO-6: This report satisfies the annual report requirement.

Publications

  • Type: Journal Articles Status: Published Year Published: 2022 Citation: Bruno J.G. Applications in Which Aptamers Are Needed or Wanted in Diagnostics and Therapeutics. Pharmaceuticals (MDPI; Open Access). 15(6), 693; 2022. https://doi.org/10.3390/ph15060693. Note: Publication includes aptamer-fluorophore staining and confocal fluorescence microscopy of Cyclospora oocysts.