Progress 02/15/22 to 02/14/23

Outputs
Target Audience:The target audience for this reporting period is coffee industry professionals and fellow experts in the field. Changes/Problems:The co-principal investigator, Frank Wilkinson, Ph.D., was unable to make substantial progress furthering the development of a quantitative detection system for Clostridium in cold-brewed coffee products in the 2022 calendar year. The co-PI is committed to continuing this effort and fulfilling the proposed specific aims described in the proposal. We are hopeful that work will resume now that several hurdles unrelated to research have been surmounted. Our initial proposal was to detect Clostridium botulinum (A BSL-3 organism) in cold-brewed coffee starting with a published protocol (Satterfield et al. 2010). We elected to start trials on the BSL-2 organism, Clostridium perfringens. Several PCR based detection strategies have been published but use conventional PCR (Baums et al. 2004; Chukwu et al. 2016; Yonogi et al. 2016; Grenda et al. 2017; Finegold et al. 2017). Other authors report success using real time PCR approaches to detect as few at ~10 genome equivalents arguing for ultimate success in our approach (Wise and Siragusa 2005; Nagpal et al. 2015; Mahamat Abdelrahim et al. 2019). Our strategy to develop a real time PCR detection strategy reached a sensitivity lower limit of ~10,000 genome equivalents (figure 1). The slope of the standard curve in the left panel of figure 1 (-4.0971) differs significantly from the -3.322 value expected from log order dilutions and suggests the presence of an inhibitor (Ruijter et al. 2021; Svec et al. 2015; Schrader et al. 2012). . The areas that remain to be optimized are as follows: ? Improve sensitivity to ~10 template copies ? Improve the DNA preparation method to remove inhibitors Further to development of the real-time PCR strategy, we will employ an assay to spike C. perfringens into cold-brewed coffee products and detect surviving cells by plating onto medium and measuring colony forming units directly. Our efforts to continue progress have been delayed due to several factors uniquely affecting the co-PI. The co-PI was obligated to apply for promotion to the rank of Professor in the spring of 2022 through a cumbersome and still-developing process. Moreover, several departures from the department obligated the co-PI to take on a new course in spring 2022 and a course overload during the fall 2022. Baums, Christoph G., Ulrich Schotte, Gunter Amtsberg, and Ralph Goethe. 2004. "Diagnostic Multiplex PCR for Toxin Genotyping of Clostridium Perfringens Isolates." Veterinary Microbiology 100 (1-2): 11-16. Chukwu, Emelda E., Francisca O. Nwaokorie, Akitoye O. Coker, Mario J. Avila-Campos, Rosa L. Solis, Luis A. Llanco, and Folasade T. Ogunsola. 2016. "Detection of Toxigenic Clostridium Perfringens and Clostridium Botulinum from Food Sold in Lagos, Nigeria." Anaerobe 42 (December): 176-81. Finegold, Sydney M., Paula H. Summanen, Julia Downes, Karen Corbett, and Tomoe Komoriya. 2017. "Detection of Clostridium Perfringens Toxin Genes in the Gut Microbiota of Autistic Children." Anaerobe 45 (June): 133-37. Grenda, Tomasz, Magdalena Grabczak, Krzysztof Kwiatek, and Andrzej Bober. 2017. "Prevalence of C. Botulinum and C. Perfringens Spores in Food Products Available on Polish Market." Journal of Veterinary Research 61 (3): 287-91. Mahamat Abdelrahim, Abakabir, Nicolas Radomski, Sabine Delannoy, Sofia Djellal, Marylène Le Négrate, Katia Hadjab, Patrick Fach, Jacques-Antoine Hennekinne, Michel-Yves Mistou, and Olivier Firmesse. 2019. "Large-Scale Genomic Analyses and Toxinotyping of Clostridium Perfringens Implicated in Foodborne Outbreaks in France." Frontiers in Microbiology 10 (April): 777. Nagpal, Ravinder, Kiyohito Ogata, Hirokazu Tsuji, Kazunori Matsuda, Takuya Takahashi, Koji Nomoto, Yoshio Suzuki, Kazunari Kawashima, Satoru Nagata, and Yuichiro Yamashiro. 2015. "Sensitive Quantification of Clostridium Perfringens in Human Feces by Quantitative Real-Time PCR Targeting Alpha-Toxin and Enterotoxin Genes." BMC Microbiology 15 (October): 219. Ruijter, Jan M., Rebecca J. Barnewall, Ian B. Marsh, Andrew N. Szentirmay, Jane C. Quinn, Robin van Houdt, Quinn D. Gunst, and Maurice J. B. van den Hoff. 2021. "Efficiency Correction Is Required for Accurate Quantitative PCR Analysis and Reporting." Clinical Chemistry 67 (6): 829-42. Satterfield, Benjamin A., Alvin F. Stewart, Cynthia S. Lew, David O. Pickett, Marissa N. Cohen, Emily A. Moore, Patrick F. Luedtke, Kim L. O'Neill, and Richard A. Robison. 2010. "A Quadruplex Real-Time PCR Assay for Rapid Detection and Differentiation of the Clostridium Botulinum Toxin Genes A, B, E and F." Journal of Medical Microbiology 59 (Pt 1): 55-64. Schrader, C., A. Schielke, L. Ellerbroek, and R. Johne. 2012. "PCR Inhibitors - Occurrence, Properties and Removal." Journal of Applied Microbiology 113 (5): 1014-26. Svec, David, Ales Tichopad, Vendula Novosadova, Michael W. Pfaffl, and Mikael Kubista. 2015. "How Good Is a PCR Efficiency Estimate: Recommendations for Precise and Robust qPCR Efficiency Assessments." Biomolecular Detection and Quantification 3 (March): 9-16. Wise, Mark G., and Gregory R. Siragusa. 2005. "Quantitative Detection of Clostridium Perfringens in the Broiler Fowl Gastrointestinal Tract by Real-Time PCR." Applied and Environmental Microbiology 71 (7): 3911-16. Yonogi, Shinya, Masashi Kanki, Takahiro Ohnishi, Masami Shiono, Tetsuya Iida, and Yuko Kumeda. 2016. "Development and Application of a Multiplex PCR Assay for Detection of the Clostridium Perfringens Enterotoxin-Encoding Genes Cpe and becAB." Journal of Microbiological Methods 127 (August): 172-75. What opportunities for training and professional development has the project provided?During this period, this research has led to the completion of one summer internship and one independent research course. One undergraduate student participated in this research. He was trained in coffee roasting, coffee brewing, sample preparation, antioxidant testing, and operation of High-Pressure Liquid Chromatography (HPLC). In addition to experimental techniques, the student was trained in literature search, experimental design, data analysis, and scientific writing. The work completed by the studentresulted in 2 peer-reviewed publications and an invited poster presentation at the 2023 American Chemical Society Spring National Conference. How have the results been disseminated to communities of interest?The efforts from this period resulted in 2 peer-reviewed journal articles and two invited presentations, one poster and one oral, at the 2023 American Chemical Society Spring National Conference. What do you plan to do during the next reporting period to accomplish the goals? Nothing Reported

Impacts
What was accomplished under these goals? Under aim 1a, we extended our study on the cold brew extracts of peaberry coffee.Peaberry coffee is the result of a natural mutation of coffee beans, and they make up only about 5-7% of coffee crops. Peaberry coffees are said to be sweeter, lighter, and more flavorful since the peaberry beans receive all nutrients from the coffee cherry. Due to its exclusive nature, the chemical characteristic of peaberry coffee is not well understood. This study explores peaberry coffee's acidities and antioxidant activity sourced from multiple regions. Total antioxidant capacity, total caffeoylquinic acid (CQA), total caffeine concentration, and pH levels were evaluated for peaberry coffee extracts prepared by cold and hot brewing methods. Little correlation between antioxidant activity and the concentrations of caffeine and CQA in peaberry beans was shown. Fivemethods were performed for the characterization of total antioxidant capacity including ABTS assay, and FRAP assay. Peaberry bean extract demonstrated higher average total caffeine concentrations compared to traditional coffee bean extracts. Table 1. Physicochemical characteristics of cold and hot brew peaberry coffee samples from four regions. TTA: total titratable acidity titrated to a pH 6.0 and pH 8.0 expressed in ml of 0.1 N NaOH per 30 mL of coffee. Coffee Samples pH TTA pH = 6 (mL of 0.1 N NaOH) TTA pH = 8 (mL of 0.1 N NaOH) Cold Brew Kenya 5.18 ± 0.01b 2.60 ± 0.01ad 5.59 ± 0.03ab Papua New Guinea 5.20 ± 0.02b 2.43 ± 0.03bd 5.21 ± 0.09b Sumatra 5.10 ± 0.01c 2.87 ± 0.01a 6.00 ± 0.01a Tanzania 5.29 ± 0.01a 2.26 ± 0.06d 5.00 ± 0.18b Hot Brew Kenya 5.08 ± 0.01c 2.76 ± 0.15ab 5.45 ± 0.29ab Papua New Guinea 5.10 ± 0.01c 2.72 ± 0.08abc 5.45 ± 0.13ab Sumatra 5.14 ± 0.01bc 2.61 ± 0.04abc 5.53 ± 0.05ab Tanzania 5.11 ± 0.01c 2.42 ± 0.05cd 4.97 ± 0.13b Table 2. 5-CQA, 4-CQA, 3-CQA, total CQA, and caffeine concentration of cold and hot brew peaberry coffee samples from four regions. Coffee Samples 5-CQA (mg/L of Coffee) 4-CQA (mg/L of Coffee) 3-CQA (mg/L of Coffee) Total CQA (mg/L of Coffee) Caffeine (mg/L of Coffee) Cold Brew Kenya 1027 ± 9bc 496 ± 4cd 404 ± 3cd 1927 ± 16cd 1315 ± 11a Papua New Guinea 981 ± 9c 477 ± 4d 387 ± 4d 1845 ± 16d 1233 ± 12bc Sumatra 1150 ± 8a 571 ± 3ab 470 ± 1ab 2192 ± 11ab 1183 ± 7cd Tanzania 1142 ± 9a 564 ± 5b 461 ± 3b 2167 ± 16b 1108 ± 8e Hot Brew Kenya 1067 ± 11b 516 ± 5c 418 ± 4c 2001 ± 19c 1283 ± 12ab Papua New Guinea 1056 ± 11b 507 ± 5cd 405 ± 4cd 1967 ± 20cd 1286 ± 14ab Sumatra 977 ± 13c 478 ± 7d 391 ± 5d 1847 ± 25d 1140 ± 8de Tanzania 1206 ± 33a 598 ± 16a 490 ± 12a 2294 ± 61a 1186 ± 31cd Table 3. Antioxidant activities, total phenolic content (TPC), and total flavonoid content (TFC) of cold and hot brew peaberry coffee samples from four regions. Coffee Samples ABTS (mg TE/L of Coffee) DPPH (mg TE/L of Coffee) FRAP (mg FeSO4/L Coffee) TPC (mg GAE/L of Coffee) TFC (mg Rutin/L of Coffee) Cold Brew Kenya 17.76 ± 0.19a 16.84 ± 0.24a 295 ± 1.0a 596 ± 4.8ac 9.55 ± 0.12ab Papua New Guinea 15.39 ± 0.34c 13.89 ± 0.11d 262 ± 3.6c 565 ± 2.6d 8.56 ± 0.06c Sumatra 17.42 ± 0.27ab 15.60 ± 0.25b 302 ± 1.9a 605 ± 1.2a 9.79 ± 0.08a Tanzania 16.70 ± 0.18b 15.13 ± 0.19bc 280 ± 3.5b 585 ± 2.7c 9.65 ± 0.05ab Hot Brew Kenya 17.57 ± 0.09ab 15.92 ± 0.27b 306 ± 1.4a 602 ± 2.8ab 9.65 ± 0.08ab Papua New Guinea 18.10 ± 0.14a 14.59 ± 0.13cd 295 ± 2.4a 592 ± 2.2bc 9.33 ± 0.06b Sumatra 17.28 ± 0.11ab 15.35 ± 0.18bc 298 ± 2.8a 602 ± 3.2ab 9.67 ± 0.07ab Tanzania 17.30 ± 0.09ab 15.84 ± 0.16b 304 ± 2.4a 600 ± 2.1ab 9.82 ± 0.11a Values are means ± SEM, n = 6. a-dMeans in a column without a common superscript letter differ (p < 0.05) as analyzed by two-way ANOVA and the TUKEY HDS post-test. Results from the current work demonstrated peaberry coffee extracts contain higher levels of caffeine than regular coffee reported in the literature. Comparisons of hot and cold brewing techniques demonstrated that cold brew peaberry coffee extracts have comparable pH and generally lower titratable acidity than their hot brew counterparts. However, the current work showed no significant difference in total antioxidant capacity between hot and cold brew extracts. The total phenolic content (TPC) of peaberry coffee extracts was observed to have a strong correlation with other total antioxidant capacities (TAC) assays, suggesting that the phenolic compounds in peaberry extracts have different modes of antioxidant activity mechanism. Moreover, the current work found that the TAC values of peaberry coffee extracts did not correlate to either caffeine concentration or CQA concentration, indicating that neither compounds were a major contributor to the antioxidant activities of peaberry coffee extract. While CV data did show expected two-electron reversibility of the phenolic antioxidants present in coffee, it did not show a significant difference in TAC between cold and hot brew peaberry coffee extracts, as further noted by TAC assay data. CV studies also resulted in the corroboration of ABTS and DPPH studies for TAC based on the different regions studied for peaberry coffee origin with Kenya having the highest TAC and Papua New Guinea having the lowest. In general, peaberry coffee is a plentiful source of antioxidants independent of brewing style. The brewed coffee from Aim 1a (spent coffee ground or SCG) was recycled as part of the starting material in the green synthesis of silver and gold nanoparticles. The extracts from SCGs of both medium and dark roasts, which were initially brewed using hot brew, cold brew, and espresso methods, were investigated. It was found that SCGs from an initial hot brew exhibited the highest CQA and TAC levels, followed by SCGs from an initial cold brew, with SCGs from an initial espresso brew exhibiting the lowest CQA and TAC levels regardless of degree of roast. Compared to dark roast SCGs, medium roast SCGs yielded higher CQA levels but lower TAC levels whether processed via hot or cold brewing methods. This trend was reversed for espresso-derived SCGs, which showed higher CQA levels and lower TAC levels for the dark roast. Table 4: Total CQA concentration and TAC levels of six (6) SCG extracts. SCG Samples Total CQA Concentration (mg/L of extract) ABTS (mmol TE/L extract) DPPH (mmol TE/L extract) TPC (mg GAE/L extract) FRAP (mg FeSO4 /L extract) SMC 480.65 ± 8.31 a,A 5.69 ± 0.59 a,A 4.23 ± 0.68 a,A 420.5 ± 16.7 a,A 145.6 ± 4.2 a,A SMH 716.02 ± 7.70 b,A 6.94 ± 0.64 b,A 5.69 ± 1.54 ab,A 534.2 ± 14.0 b,A 217.1 ± 12.3 b,A SME 221.12 ± 1.17 c,A 5.5 ± 0.37 b,A 3.57 ± 0.72 b,A 313.5 ± 8.9 c,A 111.4 ± 6.8 c,A SDC 202.72 ± 3.67 a,B 7.15 ± 0.78 a,B 5.41 ± 1.05 a,B 503.2 ± 12.6 a,B 193.3 ± 6.9 a,B SDH 277.86 ± 4.47 b,B 8.92 ± 0.59 b,B 7.6 ± 0.79 b,A 595.2 ± 11.0 b,B 254.6 ± 16.6 b,B SDE 38.88 ± 0.71 c,B 3.43 ± 0.20 c,B 2.53 ± 0.39 c,A 206.2 ± 21.1 c, 73.1 ± 2.7 c,B ?

Publications

• Type: Book Chapters Status: Published Year Published: 2022 Citation: Rao, N. Z., Wilkinson, F. H., & Yust, B. G. (2022). The effects of contact time, brewing method, and bean roast on the chemistry of cold brew coffee. In A. Ramakrishna, P. Giridhar, & M. Jeszka-Skowron (Eds.), Coffee Science (pp. 165174). CRC Press. https://doi.org/10.1201/9781003043133-15
• Type: Journal Articles Status: Published Year Published: 2022 Citation: Yust, B. G., Rao, N. Z., Schwarzmann, E. T., & Peoples, M. H. (2022). Quantification of Spent Coffee Ground Extracts by Roast and Brew Method, and Their Utility in a Green Synthesis of Gold and Silver Nanoparticles. Molecules , 27(16), 5124. https://doi.org/10.3390/molecules27165124
• Type: Journal Articles Status: Published Year Published: 2022 Citation: Schwarzmann, E. T., Washington, M. P., & Rao, N. Z. (2022). Physicochemical Analysis of Cold Brew and Hot Brew Peaberry Coffee. Processes, 10(10), 1989. https://doi.org/10.3390/pr10101989

Progress 02/15/19 to 02/14/23

Outputs
Target Audience:The target audiences for this reporting period were the general public, food science/chemistry community, and industry professionals. This was accomplished via conference presentation, publishing of manuscript, promoting research via social media, and interviews with media outlets. Changes/Problems:The co-principal investigator, Frank Wilkinson, Ph.D., was unable to make substantial progress furthering the development of a quantitative detection system forClostridiumin cold-brewed coffee products from2020 to 2022 as a result of COVID and challenges in method developement. The co-PI is committed to continuing this effort and fulfilling the proposed specific aims described in the proposal. We are hopeful that work will resume now that several hurdles unrelated to research have been surmounted. Our initial proposal was to detectClostridium botulinum(A BSL-3 organism) in cold-brewed coffee starting with a published protocol(Satterfield et al. 2010). We elected to start trials on the BSL-2 organism,Clostridium perfringens. Several PCR based detection strategies have been published but use conventional PCR(Baums et al. 2004; Chukwu et al. 2016; Yonogi et al. 2016; Grenda et al. 2017; Finegold et al. 2017). Other authors report success using real time PCR approaches to detect as few at ~10 genome equivalents arguing for ultimate success in our approach(Wise and Siragusa 2005; Nagpal et al. 2015; Mahamat Abdelrahim et al. 2019). Our strategy to develop a real time PCR detection strategy reached a sensitivity lower limit of ~10,000 genome equivalents (figure 1). The slope of the standard curve in the left panel of figure 1 (-4.0971) differs significantly from the -3.322 value expected from log order dilutions and suggests the presence of an inhibitor(Ruijter et al. 2021; Svec et al. 2015; Schrader et al. 2012). . The areas that remain to be optimized are as follows: ? Improve sensitivity to ~10 template copies ? Improve the DNA preparation method to remove inhibitors Further to development of the real-time PCR strategy, we will employ an assay to spikeC. perfringensinto cold-brewed coffee products and detect surviving cells by plating onto medium and measuring colony forming units directly. Our efforts to continue progress have been delayed due to several factors uniquely affecting the co-PI. During COVID, access to laboratory spaces was severely limited. Coupled with supply chain distruptions, the process was slow. The co-PI was obligated to apply for promotion to the rank of Professor in the spring of 2022 through a cumbersome and still-developing process. Moreover, several departures from the department obligated the co-PI to take on a new course in spring 2022 and a course overload during the fall 2022. Baums, Christoph G., Ulrich Schotte, Gunter Amtsberg, and Ralph Goethe. 2004. "Diagnostic Multiplex PCR for Toxin Genotyping of Clostridium Perfringens Isolates."Veterinary Microbiology100 (1-2): 11-16. Chukwu, Emelda E., Francisca O. Nwaokorie, Akitoye O. Coker, Mario J. Avila-Campos, Rosa L. Solis, Luis A. Llanco, and Folasade T. Ogunsola. 2016. "Detection of Toxigenic Clostridium Perfringens and Clostridium Botulinum from Food Sold in Lagos, Nigeria."Anaerobe42 (December): 176-81. Finegold, Sydney M., Paula H. Summanen, Julia Downes, Karen Corbett, and Tomoe Komoriya. 2017. "Detection of Clostridium Perfringens Toxin Genes in the Gut Microbiota of Autistic Children."Anaerobe45 (June): 133-37. Grenda, Tomasz, Magdalena Grabczak, Krzysztof Kwiatek, and Andrzej Bober. 2017. "Prevalence of C. Botulinum and C. Perfringens Spores in Food Products Available on Polish Market."Journal of Veterinary Research61 (3): 287-91. Mahamat Abdelrahim, Abakabir, Nicolas Radomski, Sabine Delannoy, Sofia Djellal, Marylène Le Négrate, Katia Hadjab, Patrick Fach, Jacques-Antoine Hennekinne, Michel-Yves Mistou, and Olivier Firmesse. 2019. "Large-Scale Genomic Analyses and Toxinotyping of Clostridium Perfringens Implicated in Foodborne Outbreaks in France."Frontiers in Microbiology10 (April): 777. Nagpal, Ravinder, Kiyohito Ogata, Hirokazu Tsuji, Kazunori Matsuda, Takuya Takahashi, Koji Nomoto, Yoshio Suzuki, Kazunari Kawashima, Satoru Nagata, and Yuichiro Yamashiro. 2015. "Sensitive Quantification of Clostridium Perfringens in Human Feces by Quantitative Real-Time PCR Targeting Alpha-Toxin and Enterotoxin Genes."BMC Microbiology15 (October): 219. Ruijter, Jan M., Rebecca J. Barnewall, Ian B. Marsh, Andrew N. Szentirmay, Jane C. Quinn, Robin van Houdt, Quinn D. Gunst, and Maurice J. B. van den Hoff. 2021. "Efficiency Correction Is Required for Accurate Quantitative PCR Analysis and Reporting."Clinical Chemistry67 (6): 829-42. Satterfield, Benjamin A., Alvin F. Stewart, Cynthia S. Lew, David O. Pickett, Marissa N. Cohen, Emily A. Moore, Patrick F. Luedtke, Kim L. O'Neill, and Richard A. Robison. 2010. "A Quadruplex Real-Time PCR Assay for Rapid Detection and Differentiation of the Clostridium Botulinum Toxin Genes A, B, E and F."Journal of Medical Microbiology59 (Pt 1): 55-64. Schrader, C., A. Schielke, L. Ellerbroek, and R. Johne. 2012. "PCR Inhibitors - Occurrence, Properties and Removal."Journal of Applied Microbiology113 (5): 1014-26. Svec, David, Ales Tichopad, Vendula Novosadova, Michael W. Pfaffl, and Mikael Kubista. 2015. "How Good Is a PCR Efficiency Estimate: Recommendations for Precise and Robust qPCR Efficiency Assessments."Biomolecular Detection and Quantification3 (March): 9-16. Wise, Mark G., and Gregory R. Siragusa. 2005. "Quantitative Detection of Clostridium Perfringens in the Broiler Fowl Gastrointestinal Tract by Real-Time PCR."Applied and Environmental Microbiology71 (7): 3911-16. Yonogi, Shinya, Masashi Kanki, Takahiro Ohnishi, Masami Shiono, Tetsuya Iida, and Yuko Kumeda. 2016. "Development and Application of a Multiplex PCR Assay for Detection of the Clostridium Perfringens Enterotoxin-Encoding Genes Cpe and becAB."Journal of Microbiological Methods127 (August): 172-75. What opportunities for training and professional development has the project provided?This research has led to the completion of twosummer internships and twoindependent research courses. Twp undergraduate students participated in this research. Bothweretrained in coffee roasting, coffee brewing, sample preparation, antioxidant testing, and operation of High-Pressure Liquid Chromatography (HPLC). In addition to experimental techniques, the students weretrained in literature search, experimental design, data analysis, and scientific writing. How have the results been disseminated to communities of interest?The results have been disseminated via the following methods Science conferences The Spring American Chemical Society National Meeting (April 2020) Meeting of the Princeton ACS Section (May 2020) 10th International Conference on Food Studies (October 2020) The Spring American Chemical Society National Meeting (March 2023) Podcast "Niny Rao and Mark Shapiro on the Science and Taste of Coffee," The Visible Voice, Episode 56 (November 2021) News Articles Huffington Post Bio-Medicine Ars Technica LabRoots Lab Manager Magazine Food & Wine Online Popular Mechanics Canada Free Press Health Medici Net Health News Report Minnesota Ag Connection Illinois Ag Connection Tech Deeps Science Daily News Caf Newswise BrightSurf.com What do you plan to do during the next reporting period to accomplish the goals? Nothing Reported

Impacts
What was accomplished under these goals? Effect of Roast on Cold brew Coffee Cold brew coffee is a popular new beverage that has seen market growth of 580% from 2011 to 2016. In contrast to hot brew coffee, cold brew coffee is produced using a low-temperature, long-contact brewing method. A range of online health and lifestyle blogs have published recipes and specific health claims for cold brew coffee without scientific basis. Despite its growing popularity, very little research has been published on cold brew coffee chemistry. This research aims to establish a foundational understanding of some key chemical metrics of cold brew coffee. Total acidity, pH, chlorogenic acid (CGA) and caffeine concentrations, and antioxidant capacity will be measured for cold brew coffee extracted from beans at three different levels of roast. The immediate output of this project is to increase scientific understanding of cold brew coffee chemistry. In this reporting period, Dr. Fuller and Dr. Rao, along with an undergraduate research assistant, completed analysis of cold brew coffee's chemical attributes using light, medium, and dark roast Columbia beans. Specifically, total acidity, pH, CGA and caffeine concentrations, and antioxidant capacity of cold brew coffee samples were measured and compared to those of hot brew counterparts. In general, the cold brew method yielded lower caffeine concentration, lower CGA concentration, and lower antioxidant capacity than the hot brew method. Coffee pH increased as roast temperature increased. At the same roast level, the pH levels of cold brew and hot brew coffee samples were comparable. It is notable that, apart from pH, all attributes of cold brew coffee samples had a direct relationship with roasting temperature. These results suggest that the bean's roasting temperature significantly impacts the chemistry of the final coffee brew and should not be ignored when crafting cold brew coffee beverages. Chemical Analysis of Cold Brew Peaberry Coffee We extended our study on the cold brew extracts of peaberry coffee.Peaberry coffee is the result of a natural mutation of coffee beans, and they make up only about 5-7% of coffee crops. Peaberry coffees are said to be sweeter, lighter, and more flavorful since the peaberry beans receive all nutrients from the coffee cherry. Due to its exclusive nature, the chemical characteristic of peaberry coffee is not well understood. This study explores peaberry coffee's acidities and antioxidant activity sourced from multiple regions. Total antioxidant capacity, total caffeoylquinic acid (CQA), total caffeine concentration, and pH levels were evaluated for peaberry coffee extracts prepared by cold and hot brewing methods. Little correlation between antioxidant activity and the concentrations of caffeine and CQA in peaberry beans was shown. Fivemethods were performed for the characterization of total antioxidant capacity including ABTS assay, and FRAP assay. Peaberry bean extract demonstrated higher average total caffeine concentrations compared to traditional coffee bean extracts.Results from thiswork demonstrated peaberry coffee extracts contain higher levels of caffeine than regular coffee reported in the literature. Comparisons of hot and cold brewing techniques demonstrated that cold brew peaberry coffee extracts have comparable pH and generally lower titratable acidity than their hot brew counterparts. However, the studyshowed no significant difference in total antioxidant capacity between hot and cold brew extracts. The total phenolic content (TPC) of peaberry coffee extracts was observed to have a strong correlation with other total antioxidant capacities (TAC) assays, suggesting that the phenolic compounds in peaberry extracts have different modes of antioxidant activity mechanism. Moreover, the current work found that the TAC values of peaberry coffee extracts did not correlate to either caffeine concentration or CQA concentration, indicating that neither compounds were a major contributor to the antioxidant activities of peaberry coffee extract. While CV data did show expected two-electron reversibility of the phenolic antioxidants present in coffee, it did not show a significant difference in TAC between cold and hot brew peaberry coffee extracts, as further noted by TAC assay data. CV studies also resulted in the corroboration of ABTS and DPPH studies for TAC based on the different regions studied for peaberry coffee origin with Kenya having the highest TAC and Papua New Guinea having the lowest. In general, peaberry coffee is a plentiful source of antioxidants independent of brewing style. Chemical Analysis of Cold Brew Spent Coffee Ground Extracts The brewed coffee from Aim 1a (spent coffee ground or SCG) was recycled as part of the starting material in the green synthesis of silver and gold nanoparticles. The extracts from SCGs of both medium and dark roasts, which were initially brewed using hot brew, cold brew, and espresso methods, were investigated. It was found that SCGs from an initial hot brew exhibited the highest CQA and TAC levels, followed by SCGs from an initial cold brew, with SCGs from an initial espresso brew exhibiting the lowest CQA and TAC levels regardless of degree of roast. Compared to dark roast SCGs, medium roast SCGs yielded higher CQA levels but lower TAC levels whether processed via hot or cold brewing methods. This trend was reversed for espresso-derived SCGs, which showed higher CQA levels and lower TAC levels for the dark roast.

Publications

• Type: Conference Papers and Presentations Status: Published Year Published: 2020 Citation: M.D.Grim, N.Z.Rao, M.Fuller, Role of Roast on Chemical Characteristics of Cold Brew Coffee, ACS Spring 2020 National Meeting and Expo, SciMeeting, 4/1/2020, DOI:10.1021/scimeetings.0c00851.
• Type: Conference Papers and Presentations Status: Published Year Published: 2020 Citation: N.Z.Rao, M.Fuller, M.D.Grim, Role of Roast on Chemical Characteristics of Cold Brew Coffee, Tenth International Conference on Food Studies, New York, NY, 10/17/2020.
• Type: Conference Papers and Presentations Status: Accepted Year Published: 2023 Citation: N.Z. Rao, Chemistry in your cup: Chemical characteristics of cold brew coffee, ACS Spring 2023 National Meeting and Expo, 3/29/2023

Progress 02/15/21 to 02/14/22

Outputs
Target Audience: Nothing Reported Changes/Problems:The research team, in consultation with the institution biosafety officer, elected to useClostridium perfringensas a model organism forC botulinum.C botulinumrequires a BSL-3 facility and the campus where the research staff are performing the work is limited to accessing a BSL-2 level facility. SinceC perfringensis a food spoilage organism in its own right, we thought that this model organism would yield important information about the ability of cold brewed coffee products to support the growth ofClostridiumspecies. PCR development Firstly, our aim was to develop sensitive PCR detection ofC perfringens.Detection by real time PCR was reported with sensitivity ranging from 1000(Yonogi et al., 2016)to approximately 20 genome equivalents(Wise & Siragusa, 2005). A strain, and isolated genomic DNA, were found to be available from ATCC (ATCC 13124). This strain is positive for the toxin genes Perfringolysin O (pfoA) and Alpha toxin (cpa) as confirmed by PCR at ATCC(Clostridium Perfringens (Veillon and Zuber) Hauduroy et Al, n.d.)and in our hands. A primer set forpfoAdetection (211 bp product) was obtained from a published source(Mahamat Abdelrahim et al., 2019). The primer set forcpa(444 bp) was designed using Lasergene software, PrimerSelect (DNAstar, Madison WI). See table 1 for the primer sequences Table 1 Primer combinations developed for detection of pfoA and cpa DNA Primer name sequence pfoA-F TGGAGCCTATGTTGCACAGT pfoA-R ATCTCTCCACCATTCCCAAG cpa-F CTACGCTTGGGATGGAAAAAT cpa-R GCGCTATCAACGGCAGTAAC We decided to clone the toxin gene amplicons into plasmids that could serve as an easily-dilutable template. PCR products were obtained and cloned into a commercial vector pCR-4-TOPO and verified at the sequence level to be free of mutations from cloning. In each alignment (Query), a miscalled nucleotide, "N," was verified by inspection of the chromatograms to be consistent with the nucleotide predicted by the sequence information. Trials with thecpatemplate yielded reliable products when diluted to a low point of ~10^5 copies of the plasmid. Absorbance at 260 nm was used to determine the concentration of the isolated plasmid. The template was diluted to defined copies per reaction. The reactions were run in 20 μl using 0.05 units of Jumpstart Hot Start Taq DNA polymerase (SigmaAldrich) and supplied reaction buffer, 200 μM dNTPs, 0.4 μM each primer, 10% v/v DMSO, and 1X SYBR Green I. Reaction cycling included an initial denaturation at 94°C for 90 seconds, then 35 cycles of 94°C for 15 seconds, 57°C for 15 seconds, and 72°C for 30 seconds in a MJ MiniOpticon (BioRad). SYBR green fluorescence was determined at the conclusion of the 72°C step. Threshold cycle values were determined using the Opticon Monitor software (BioRad). A plot of Ct values as a function of template copy number yields a straight line with R2of 0.9717. The determined slope for this curve -4.0971 is outside of the range of -3.58 and -3.10 generally considered "good." Moreover, analysis of the PCR products by agarose gel electrophoresis indicated aberrant mobility of PCR products for template concentrations less than 100000 per reaction. These observations suggest that the reaction conditions need to be further optimized. Beyond this assay development forcpa, the detection of thepfoAamplicon needs to be optimized. Table 2 Real Time PCR data for cpa template titration Template copy number Log10 (template copy number) Ct value 10000000 7 16.3 5000000 6.69897 16.76 1000000 6 17.98 500000 5.69897 21.16 100000 5 23.88 50000 4.69897 25.01 10000 4 28.01 0 undefined 27.46 C. perfringens detection The next stage of the research is to detect authentic C perfringens in cold brewed coffee. Initially, we desired to isolate genomic DNA from coffee directly using chelex and boiling to disrupt the cell wall following a protocol published by Auricchio, et al. (Auricchio et al., 2013). Quantitative PCR detection of cpa and pfoA amplicons would then be interpreted as genome equivalents (approximating the number of cfu) from a standard curve similar to that in Figure 3. In light of the limited PCR sensitivity, currently ~100000 genome equivalents, we plan to detect the organism directly (as colony forming units per milliliter cfu/ml). In a typical experiment, C. perfringens will be delivered into lab-prepared, cold brewed coffee products diluted to a defined cfu/ml. The inoculated coffee will be contained in glass test tubes, the headspace will be purged with anaerobic gas (85% nitrogen, 10% carbon dioxide, 5% hydrogen), and closed with a butyl rubber stopper. Following incubation under anaerobic conditions, a sample of the inoculated coffee will be plated onto the recommended medium (either ATCC Medium 2107, Modified Reinforced Clostridial or ATCC Medium 260, Tryptic Soy Medium with 5% Defibrinated Sheep Blood). Colonies will be counted following anaerobic incubation of the agar plates. Verification of the identity of the recovered organism will use the PCR strategy being developed above. References Auricchio, B., Anniballi, F., Fiore, A., Skiby, J. E., & De Medici, D. (2013). Evaluation of DNA extraction methods suitable for PCR-based detection and genotyping of Clostridium botulinum. Biosecurity and Bioterrorism: Biodefense Strategy, Practice, and Science, 11 Suppl 1, S200-S206. Clostridium perfringens (Veillon and Zuber) Hauduroy et al. (n.d.). American Type Culture Collection. Retrieved December 3, 2021, fromhttps://www.atcc.org/products/13124-mini-pack Mahamat Abdelrahim, A., Radomski, N., Delannoy, S., Djellal, S., Le Négrate, M., Hadjab, K., Fach, P., Hennekinne, J.-A., Mistou, M.-Y., & Firmesse, O. (2019). Large-Scale Genomic Analyses and Toxinotyping of Clostridium perfringens Implicated in Foodborne Outbreaks in France.Frontiers in Microbiology,10, 777. Wise, M. G., & Siragusa, G. R. (2005). Quantitative detection of Clostridium perfringens in the broiler fowl gastrointestinal tract by real-time PCR.Applied and Environmental Microbiology,71(7), 3911-3916. Yonogi, S., Kanki, M., Ohnishi, T., Shiono, M., Iida, T., & Kumeda, Y. (2016). Development and application of a multiplex PCR assay for detection of the Clostridium perfringens enterotoxin-encoding genes cpe and becAB.Journal of Microbiological Methods,127, 172-175. What opportunities for training and professional development has the project provided? Nothing Reported How have the results been disseminated to communities of interest? Nothing Reported What do you plan to do during the next reporting period to accomplish the goals?The next stage of the research is to detect authentic C perfringens in cold brewed coffee. Initially, we desired to isolate genomic DNA from coffee directly using chelex and boiling to disrupt the cell wall following a protocol published by Auricchio, et al. (Auricchio et al., 2013). Quantitative PCR detection of cpa and pfoA amplicons would then be interpreted as genome equivalents (approximating the number of cfu) from a standard curve similar to that in Figure 3. In light of the limited PCR sensitivity, currently ~100000 genome equivalents, we plan to detect the organism directly (as colony forming units per milliliter cfu/ml). In a typical experiment, C. perfringens will be delivered into lab-prepared, cold brewed coffee products diluted to a defined cfu/ml. The inoculated coffee will be contained in glass test tubes, the headspace will be purged with anaerobic gas (85% nitrogen, 10% carbon dioxide, 5% hydrogen), and closed with a butyl rubber stopper. Following incubation under anaerobic conditions, a sample of the inoculated coffee will be plated onto the recommended medium (either ATCC Medium 2107, Modified Reinforced Clostridial or ATCC Medium 260, Tryptic Soy Medium with 5% Defibrinated Sheep Blood). Colonies will be counted following anaerobic incubation of the agar plates. Verification of the identity of the recovered organism will use the PCR strategy being developed above. Concurrently, the chemistry of the storedlab-prepared cold-brewed coffee will be analyzed at regular intervals for up to 3 weeks.

Impacts
What was accomplished under these goals? Progress on the testing for Clostridium botulinum in cold brewed coffee has been slow. Some of the delays are attributed to COVID-19 mitigation measures enacted in March 2020. Researchers were unable to access the research lab for many months. Other reasons for the delay are related to difficulty in developing a sensitive PCR protocol capable of detecting fewer than ~100,000 (10^5) copies of the template DNA. Though progress was slow, we are poised to continue efforts through the next stages of assay development. The research team, in consultation with the institution biosafety officer, elected to use Clostridium perfringens as a model organism for C botulinum. C botulinum requires a BSL-3 facility and the campus where the research staff are performing the work is limited to accessing a BSL-2 level facility. Since C perfringens is a food spoilage organism in its own right, we thought that this model organism would yield important information about the ability of cold brewed coffee products to support the growth of Clostridium species. PCR development Firstly, our aim was to develop sensitive PCR detection of C perfringens. Detection by real time PCR was reported with sensitivity ranging from 1000 (Yonogi et al., 2016) to approximately 20 genome equivalents (Wise & Siragusa, 2005). A strain, and isolated genomic DNA, were found to be available from ATCC (ATCC 13124). This strain is positive for the toxin genes Perfringolysin O (pfoA) and Alpha toxin (cpa) as confirmed by PCR at ATCC (Clostridium Perfringens (Veillon and Zuber) Hauduroy et Al, n.d.) and in our hands. A primer set for pfoA detection (211 bp product) was obtained from a published source (Mahamat Abdelrahim et al., 2019). The primer set for cpa (444 bp) was designed using Lasergene software, PrimerSelect (DNAstar, Madison WI). See table 1 for the primer sequences Table 1 Primer combinations developed for detection of pfoA and cpa DNA Primer name sequence pfoA-F TGGAGCCTATGTTGCACAGT pfoA-R ATCTCTCCACCATTCCCAAG cpa-F CTACGCTTGGGATGGAAAAAT cpa-R GCGCTATCAACGGCAGTAAC We decided to clone the toxin gene amplicons into plasmids that could serve as an easily-dilutable template. PCR products were obtained and cloned into a commercial vector pCR-4-TOPO and verified at the sequence level to be free of mutations from cloning. In each alignment (Query), a miscalled nucleotide, "N," was verified by inspection of the chromatograms to be consistent with the nucleotide predicted by the sequence information. Trials with the cpa template yielded reliable products when diluted to a low point of ~10^5 copies of the plasmid. Absorbance at 260 nm was used to determine the concentration of the isolated plasmid. The template was diluted to defined copies per reaction. The reactions were run in 20 μl using 0.05 units of Jumpstart Hot Start Taq DNA polymerase (SigmaAldrich) and supplied reaction buffer, 200 μM dNTPs, 0.4 μM each primer, 10% v/v DMSO, and 1X SYBR Green I. Reaction cycling included an initial denaturation at 94°C for 90 seconds, then 35 cycles of 94°C for 15 seconds, 57°C for 15 seconds, and 72°C for 30 seconds in a MJ MiniOpticon (BioRad). SYBR green fluorescence was determined at the conclusion of the 72°C step. Threshold cycle values were determined using the Opticon Monitor software (BioRad). A plot of Ct values as a function of template copy number yields a straight line with R2of 0.9717. The determined slope for this curve -4.0971 is outside of the range of -3.58 and -3.10 generally considered "good." Moreover, analysis of the PCR products by agarose gel electrophoresis indicated aberrant mobility of PCR products for template concentrations less than 100000 per reaction. These observations suggest that the reaction conditions need to be further optimized. Beyond this assay development for cpa, the detection of the pfoA amplicon needs to be optimized. Table 2 Real Time PCR data for cpa template titration Template copy number Log10 (template copy number) Ct value 10000000 7 16.3 5000000 6.69897 16.76 1000000 6 17.98 500000 5.69897 21.16 100000 5 23.88 50000 4.69897 25.01 10000 4 28.01 0 undefined 27.46 References ?Clostridium perfringens (Veillon and Zuber) Hauduroy et al. (n.d.). American Type Culture Collection. Retrieved December 3, 2021, from https://www.atcc.org/products/13124-mini-pack Mahamat Abdelrahim, A., Radomski, N., Delannoy, S., Djellal, S., Le Négrate, M., Hadjab, K., Fach, P., Hennekinne, J.-A., Mistou, M.-Y., & Firmesse, O. (2019). Large-Scale Genomic Analyses and Toxinotyping of Clostridium perfringens Implicated in Foodborne Outbreaks in France. Frontiers in Microbiology, 10, 777. Wise, M. G., & Siragusa, G. R. (2005). Quantitative detection of Clostridium perfringens in the broiler fowl gastrointestinal tract by real-time PCR. Applied and Environmental Microbiology, 71(7), 3911-3916. Yonogi, S., Kanki, M., Ohnishi, T., Shiono, M., Iida, T., & Kumeda, Y. (2016). Development and application of a multiplex PCR assay for detection of the Clostridium perfringens enterotoxin-encoding genes cpe and becAB. Journal of Microbiological Methods, 127, 172-175.

Publications

Progress 02/15/20 to 02/14/21

Outputs
Target Audience:The target audiences for this reporting period were the general public, food science/chemistry community, andindustry professionals. This was accomplished via conference presentation, publishing of manuscript, promoting research via social media, and interviews with media outlets. During this reporting period, the group presented the project at the Spring American Chemical Society National Meeting (April2020). https://www.acs.org/content/acs/en/pressroom/newsreleases/2020/april/using-chemistry-to-unlock-the-difference-between-cold--and-hot-brew-coffee-video.html The project was also written in Huffington Post for the general public. https://www.huffpost.com/entry/why-cold-brew-hot-coffee-taste-different_l_5ee90cdbc5b62d05aa17e616 Changes/Problems: Nothing Reported What opportunities for training and professional development has the project provided? Nothing Reported How have the results been disseminated to communities of interest?The results have been disseminated via the following methods Science conferences The Spring American Chemical Society National Meeting (April 2020) https://www.acs.org/content/acs/en/pressroom/newsreleases/2020/april/using-chemistry-to-unlock-the-difference-between-cold--and-hot-brew-coffee-video.html Meeting of the Princeton ACS Section(May 2020) http://chemists.princeton.edu/pacs/news/aliquotes/aliquotesv30n2-for-april-may/ 10th International Conference on Food Studies (October 2020) News Articles Huffington Post Bio-Medicine Ars Technica LabRoots Lab Manager Magazine Food & Wine Online Popular Mechanics Canada Free Press Health Medici Net Health News Report Minnesota Ag Connection Illinois Ag Connection Tech Deeps Science Daily News Caf Newswise BrightSurf.com What do you plan to do during the next reporting period to accomplish the goals?We plan to complete Aim 1b and 2 as outlined in our proposal.

Impacts
What was accomplished under these goals? We have completed Aim 1a. Aim 1b and 2 were stopped due to COVID-19 lockdowns.

Publications

• Type: Journal Articles Status: Published Year Published: 2020 Citation: Rao, N. Z., Fuller, M., & Grim, M. D. (2020). Physiochemical characteristics of hot and cold brew coffee chemistry: The effects of roast level and brewing temperature on compound extraction. Foods, 9(7), 902.

Progress 02/15/19 to 02/14/20

Outputs
Target Audience: Nothing Reported Changes/Problems: Nothing Reported What opportunities for training and professional development has the project provided?During this reporting period, this research has led to the completion of one summer internship and one independent research course. One undergraduate student participated in this research. She was trained in coffee roasting, coffee brewing, sample preparation, antioxidant testing, and operation of High-Pressure Liquid Chromatography (HPLC). In addition to experimental techniques, the student was trained in literature search, experimental design, data analysis, and scientific writing. How have the results been disseminated to communities of interest? Nothing Reported What do you plan to do during the next reporting period to accomplish the goals? Nothing Reported

Impacts
What was accomplished under these goals? Cold brew coffee is a popular new beverage that has seen market growth of 580% from 2011 to 2016. In contrast to hot brew coffee, cold brew coffee is produced using a low-temperature, long-contact brewing method. A range of online health and lifestyle blogs have published recipes and specific health claims for cold brew coffee without scientific basis. Despite its growing popularity, very little research has been published on cold brew coffee chemistry. This research aims to establish a foundational understanding of some key chemical metrics of cold brew coffee. Total acidity, pH, chlorogenic acid (CGA) and caffeine concentrations, and antioxidant capacity will be measured for cold brew coffee extracted from beans at three different levels of roast. The immediate output of this project is to increase scientific understanding of cold brew coffee chemistry. In this reporting period, Dr. Fuller and Dr. Rao, along with an undergraduate research assistant, completed analysis of cold brew coffee's chemical attributes using light, medium, and dark roast Columbia beans. Specifically, total acidity, pH, CGA and caffeine concentrations, and antioxidant capacity of cold brew coffee samples were measured and compared to those of hot brew counterparts. In general, the cold brew method yielded lower caffeine concentration, lower CGA concentration, and lower antioxidant capacity than the hot brew method. Coffee pH increased as roast temperature increased. At the same roast level, the pH levels of cold brew and hot brew coffee samples were comparable. It is notable that, apart from pH, all attributes of cold brew coffee samples had a direct relationship with roasting temperature. These results suggest that the bean's roasting temperature significantly impacts the chemistry of the final coffee brew and should not be ignored when crafting cold brew coffee beverages. Aim 1a: Cold brew and hot brew experiments were conducted using Columbia green coffee beans roasted to three different levels: light, medium, and dark. Roasting was done in-house with a Hot Top Coffee Roaster (Model No. KN-8828B-2K) using the manufacturer's default setting. The roasted beans were then ground, sieved, and brewed using both cold and hot brewing methods. For cold brew experiments, 20 g of coffee grinds and 200 mL of deionized (DI) water were placed together in a beaker fitted with a French press plunger for 7 hours at room temperature (20?C), then filtered. For hot brew experiments, 200 mL of DI water at 100°C was poured onto 20 g of coffee grinds in a beaker fitted with a French press plunger. The hot brew rested for 6 minutes before filtering. All samples were analyzed within 10 minutes of brewing. CGA concentration, caffeine concentration, total acidity, pH, and total antioxidant activity were measured for each sample. The concentration of 3-CQA and the concentration of caffeine was determined using an Agilent 1200 Series HPLC system fitted with a Supelco 5 µm column (15 cm × 4.6 cm) (Supelco, Bellefonte, PA) and run at 25.0°C, with a mixture of 75% mobile phase A and 25% mobile phase B (A: 95% 2.0 mM phosphoric acid and 5% methanol; B: 95% methanol and 5% 2.0 mM phosphoric acid). The flow rate was 1.0 mL/min with an injection volume of 10.0 µL. Calibration curves with known concentrations of 3-CQA and caffeine were used to quantify each component present in the sample. The pH of each sample was measured with a Mettler Toledo FiveEasyTM F20 benchtop pH/mV meter. The total acidity of each sample was determined by titrating 40 mL aliquot of coffee brew with 0.1 N NaOH to a pH value of 6.5. The total acidity was reported as milliliters of 0.1 N NaOH per 40 mL of coffee brew. The antioxidant activity of each sample was determined using a 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) decolorization assay. 5.0 µL aliquot of coffee sample was pipetted into 3.0 mL of the dilute ABTS solution and allowed to stand for 6 minutes. The resulting solution was analyzed by UV-Vis at 734 nm. Each measurement was compared with a Trolox standard. The total antioxidant capacity of each coffee sample was calculated as millimoles equivalence Trolox per liter of brewed coffee. Data collected from this reporting period are listed in Table1 and 2. Table 1. Cold Brew Coffee Samples: CGA concentration (milligrams per liter of brewed coffee), caffeine concentration (milligrams per liters of brewed coffee), total antioxidant activity (millimoles equivalence Trolox per liter of brewed coffee), pH, and total acidity titrated to pH of 6.5 (mL of 0.10 N NaOH per 40 milliliters of brewed coffee) (mean ± standard deviation) Roast CGA (mg/L) Caffeine (mg/L) Antioxidant Activity (mmol equivalence Trolox/L coffee) pH Total Acidity pH=6.5 (mL of 0.10N NaOH) Light 743 ± 24 1148 ± 32 13.22 ± 0.36 4.98 ± 0.03 5.20 ± 0.15 Medium 354 ± 5 1035 ± 18 11.13 ± 0.30 4.98 ± 0.01 3.15 ± 0.06 Dark 149 ± 6 953 ± 35 10.32 ± 0.72 5.74 ± 0.02 1.52 ± 0.05 Table 2. Hot Brew Coffee Samples: CGA concentration (milligrams per liter of brewed coffee), concentration of caffeine (milligrams per liters of brewed coffee), total antioxidant activity (millimoles equivalence Trolox per liter of brewed coffee), pH, and total acidity titrated to pH of 6.5 (mL of 0.10 N NaOH per 40 milliliters of brewed coffee) of hot brew coffee samples (mean ± standard deviation) Roast CGA (mg/L) Caffeine (mg/L) Antioxidant Activity (mmol equivalence Trolox/L) pH Total Acidity pH=6.5 (mL of 0.10 N NaOH) Light 630 ± 20 1054 ± 39 13.71 ± 0.39 4.80 ± 0.01 5.49 ± 1.04 Medium 350 ± 15 1056 ± 47 14.12 ± 0.55 5.04 ± 0.01 3.21 ± 0.71 Dark 139 ± 7 1055 ± 46 13.44 ± 0.61 5.39 ± 0.03 2.06 ± 0.06 The observed differences in pH, total titratable acidity, and antioxidant capacity of cold and hot brew methods were likely due, in part, to both 1) structural and chemical changes in coffee beans during the roasting process, and 2) the interaction of the solid matrix with extraction waters at different temperatures. ?The difference in extraction water temperature between hot and cold brewing causes differential solubility of higher molecular mass compounds, specifically melanoidins. The extraction behavior and antioxidant activity of melanoidins in coffees are not fully understood, as the compounds are often present in complex mixtures and likely co-present with polysaccharides, proteins, and other phenolic compounds (Nunes and Coimbra 2010). The work presented here suggests that water temperature influences wetting and matrix behavior, as well as compound solubility and extraction yield. The temperature-dependence of solubility, specifically for melanoidin compounds, is likely the cause of the differences in pH, total titratable acidity, and antioxidant capacity between the hot and cold brew coffees studied here. The key outcome from this study is that the impact of roast level on the extraction of coffee cannot be ignored. Varying the roast of coffee beans will change the chemical profile of the final brewed coffee product. This finding will be of interest to both coffee brewers and consumers. This work has been accepted by the American Chemical Society Spring 2020 Conference in Philadelphia and will be presented as a poster in March of 2020. References Nunes, F. M., & Coimbra, M. A. (2010). Role of hydroxycinnamates in coffee melanoidin formation. Phytochemistry Reviews, 9(1), 171-185. Aim 1b To be completed in the next reporting period. Aim 2 To be completed in the next reporting period.

Publications