Progress 12/22/15 to 09/30/18
Outputs
Target Audience:
Nothing Reported
Changes/Problems:Our studies, as well as studies performed in other laboratories, demonstrated that RNA and DNA aptamers represent viable tools for constructing nanosensors. However, despite recent advances in SELEX technology, none of published aptamers proved to be suitable for detection of Salmonella on farm collected fruits. It is possible that Salmonella is not the best target for aptamer-based nanosensor. We believe that aptamer-based nanosensor might work better in detection of fungi infected crops, because fungal crop diseases can be identified by visual inspection. This approach is frequently used in underdeveloped countries. Because spores of many fungi are very similar, there a need for an approach that will enhance conventional visual inspection of diseased crops. To address this need, we plan to collaborate with CIMMYT scientist in Nairobi, Kenia on developing aptamer-based instant identification of Cercospora zeae and Puccinia graminis, the fungi that cause devastating gray leaf spot and stem rust diseases of corn and wheat, respectively. We believe that the aptamers-based technology developed in the past three years will prove succesful for detection of fungal spores because they are bigger and less likely to change their appearance than Salmonella spp. What opportunities for training and professional development has the project provided?
Nothing Reported
How have the results been disseminated to communities of interest?As usual, we presented our research at the 2018 DairyU conference/workshop organized by Auburn University researchers working on projects related to animal health. Every year, this conference attracts 50-55 students, ranging from 9 to 17 years, who are interested in agriculturally focused research and business careers. What do you plan to do during the next reporting period to accomplish the goals?
Nothing Reported
Impacts
What was accomplished under these goals?
Salmonella spp. are important bacterial pathogens and significant causative agents of food-borne diseases worldwide. Among more than 2,500 serovars of Salmonella enterica, Salmonella enterica serovar Enteritidis (S. Enteritidis), emerged as a major cause of human salmonellosis worldwide and remains an important concern to the poultry industry. In our studies, we used Systemic Evolution of Ligands by Exponential enrichment (SELEX) technology to identify DNA aptamers that can strongly and specifically bind to Sallmonella cells. Our plan was to construct fluorescent nanoparticles programmed with Salmonella-specific DNA aptamers and use them as sensors for the naked eye detection of Salmonella colonies under visible blue light. The main achievement: We were able to construct fluorescently labeled nanoparticles derivatized with DNA aptamers that bind to Salmonella cells. This technology is protected by our patent # US 10,064,953 B2. We have demonstrated that such nanoparticles can be used in the laboratory environment to visualize Salmonella colonies on infected raspberries. Unfortunately, in our further studies, we determined that our DNA aptamers display very limited specificity toward Salmonella found on the fruits collected on the farm. Using PCR-based assays, we established that our DNA aptamers can also bind to S. Typhimurium ATCC13311, Escherichia coli K91Bk, Escherichia coli DH5alpha and Escherichia coli K12. To rescue our project, we tried to develop new DNA aptamers that exclusively bind to S. Enteritidis. The new strategy involved isolation of the lipopolysaccharide (LPS) complexes associated with the outer membrane of the S. Enteritidis cells. Lipopolysaccharides are complex amphiphilic molecules with a molecular weight of about 10 kDA. They vary widely in chemical composition both between and among bacterial species. Therefore, we believed that DNA aptamers specifically binding to S. Enteritidis LPS molecules will be better suited for detecting Salmonella species identified using PCR-based assays on fruits collected in the farm environment. Our SELEX experiments produced six LPS-binding aptamers with very low affinity toward their target. Finally, we tested suitability of the S25 RNA aptamer, which was developed by Kun-Ho Seo laboratory for detection of S. Enteritidis (Ji-Yeon Hyeon et al. ,2012, Journal of Microbiological methods, 79-82). According to authors, the S25 RNA aptamer binds specifically without any cross reactivity with other Salmonella serovars. Unfortunately, copies of the S25 RNA aptamer, which were produced in our laboratory failed to bind to any Salmonella serovar stored in our laboratory and on fruits collected on the farm. There are many reasons why DNA and RNA aptamers, which we have tested for their suitability for Salmonella detection, failed to detect Salmonella on the field collected fruit samples. First of all, the concentration of bacteria on the fruit surface is probably too low. Another reason, our aptamers were isolated for the binding to bacteria growing in the liquid culture. The bacteria, which we tried to detect on the farm collected fruits, grew on the solid surface. Moreover, Salmonella found on farm collected fruits may forms mini films that hide molecule targets, which our aptamers were "trained" to detect. Finally, it is possible that the "spots" of Salmonella on farm collected fruits are too small to be detected by the naked eye approach.
Publications
|
Progress 10/01/16 to 09/30/17
Outputs
Target Audience:Our research was presented at the conference listed below. Every year this conference is attended by several thousand researchers and students. 82 participants picked up miniature copies of our posters. Wower, I.K., Suh S-J. and Wower, J. (2017) Fluorescent RNA sensors for instant detection of pathogens and environmental pollutants. 232nd ECS Meeting, National Harbor, MD. October 1-6, 2017. Changes/Problems:We believe that it should be possible to isolate RNA aptamers that specifically and strongly bind to purified LPS molecules. However, it is not clear whether these aptamers could be used for detection of Salmonella enterica in environmental samples. Because we were unable to secure intramural funding for this project, we cannot pursue the main goal of the proposed research. What opportunities for training and professional development has the project provided?
Nothing Reported
How have the results been disseminated to communities of interest?
Nothing Reported
What do you plan to do during the next reporting period to accomplish the goals?I would like to terminate this project.
Impacts
What was accomplished under these goals?
The detection of Salmonella enterica in complex sample matrices such as foods, feces, and environmental samples is challenging for a number of reasons. First time-consuming culture-based enrichment steps are almost always necessary to increase target copy number prior to the application of detection methods. Second, because there are over 2,500 serovars for S. enterica, identification of this bacterium to the serovar level adds another layer of complexity. In addition, residual matrix-associated inhibitors oftentimes compromise detection, impacting both assay sensitivity and specificity. Accomplishments: (1) Using cell-SELEX approach, we were able to identify four 80 nucleotide-long RNA molecules that bound at ~4 uM concentration to Salmonella enterica Typhimurium ATCC 14028 grown in a liquid monoculture. (2) Further studies revealed that none of these RNA molecules binds exclusively to S. enterica Typhimurium ATCC 14028. All isolated RNA aptamer candidates were also able to bind to S. typhimurium ATCC13311, E. coli K91Bk, E. coli DH5alpha, and E. coli K12. (3) Structural analysis demonstrated that the four isolated RNA molecules are composed of three double-helical segments. Two helices adopted a hairpin structure and were capped with loops composed of either 7 or 4 nucleotides. (4) We synthesized four RNA hairpins (shorter versions of RNA aptamer candidates). None of them was able to bind to bacteria listed above (points 1 and 2). This finding suggests that a complex three-dimensional structure of 80 nucleotide-long RNA was important for non-specific recognition of both Salmonella and Escherichia species. (5) The surface of the gram-negative bacterium mediates its interactions with the host. Lipopolysaccharide (LPS), a major component of the surface has received much attention as a target for the detection of Salmonella enterica by antibodies. Some laboratories reported isolation of DNA aptamers specifically binding to the LPS. None of these aptamers have ever been commercialized. We isolated LPS from five Salmonella serovars that were obtained from Salmonella Genetic Stock (Calgary, CA) collection. (6) Our efforts to select RNA aptamers specfically binding to a mixture of LPS molecules isolated from five Salmonella enterica serovars were unsuccessful.
Publications
- Type:
Conference Papers and Presentations
Status:
Published
Year Published:
2017
Citation:
Wower, I.K., Suh S-J. and Wower, J. (2017) Fluorescent RNA sensors for instant detection of pathogens and environmental pollutants. 232nd ECS Meeting, National Harbor, MD. October 1-6, 2017.
|
Progress 12/22/15 to 09/30/16
Outputs
Target Audience:Dr. Wower participated 2016 Beef Cattle Conference (August 13, 2016) at Auburn University, Auburn, AL. He gave a presentation entitled "Bending the curve through investment in research innovation". Changes/Problems:
Nothing Reported
What opportunities for training and professional development has the project provided?My graduate students presented their research at conferences organized by Auburn University and the Montgomery College. Poster presented by Mr. Ricky Whitener was selected for the second prize at the College of Agriculture Poster Night. How have the results been disseminated to communities of interest?On April 23, more than 160 people turned out for Auburn University's eighth annual Dairy Awareness Introductory Resource for Youth University (DAIRY) program, the largest turnout in the program's history. Dr. Wower and his "student helpers" demonstrated their "naked eye" pathogen detection technology to high school students and their teachers. What do you plan to do during the next reporting period to accomplish the goals?During the next reporting period, we plan to carry out the following research activities: 1. We will carry out a large-scale purification of a core oligosaccharide isolated from Salmonella lipopolysaccharide. 2. We will use SELEX technology to identify RNA aptamers that can bind strongly and specifically to the purified core oligosaccharide and to selected serovars of Salmonella enterica. 3. We will use a "train" approach to construct GFR concatamers. 4. We will identify the best approach for protecting GFR trains and core oligosaccharide-specific RNA aptamers from ribonucleases produced by Salmonella cells.
Impacts
What was accomplished under these goals?
Recent outbreaks of Salmonella have demonstrated that it is necessary to develop rapid assays for the detection of this bacterium to minimize potential damage to human health. Of the more than 2,300 closely related Salmonella serovars, Salmonella enterica serovar Typhimurium is an important human pathogen that can be readily transmitted through contaminated food and water. Until recently, monoclonal and polyclonal antibodies were the most commonly used affinity ligands for capture and visualization of Salmonella on contaminated foods. We have proposed an alternative approach which uses two nucleic acid aptamers. One aptamer specifically recognizes Salmonella enterica cells. The green fluorescent RNA (GFR) acts as the second aptamer. Because GFR emits bright green fluorescence, Salmonella cells are expected to be readily detected by the naked eye. Our approach can be used for the detection of any pathogenic bacteria including Escherichia coli 0157H7 and Listeria monocytogenes. To develop this novel aptamer-based technology, we have proposed to (1) synthesize concatamers of green fluorescent RNA (GFR) aptamers for use in enhanced target detection, (2) construct supramolecular assemblies of streptavidin and GFR aptamer, (3) synthesize RNA and DNA aptamers that specifically recognize and bind to common foodborne bacterial pathogens including Salmonella enterica, Listeria monocytogenes and Escherichia coli 0157:H7, (4) use the new assays for naked eye detection of these bacterial pathogens. Specific accomplishments: Synthesis of GFR concatamers. Efforts to synthesize concatamers of GFR were only partially successful. Using the linearized pConcat plasmid, which has been developed in our laboratory, we could synthesize RNA strands composed of up to five GFR modules. However, these GFR concatamers did not emit fluorescence as brightly as expected. Further analysis revealed that only two to three GFR modules were properly folded and able to bind 3,5-difluoro-4-hydroxybenzylidene imidazolinone (DFHBI), a derivative of the conditional fluorophore 4-hydroxybenzlidene imidazolinone (HBI), which has been found to bind to green fluorescent proteins. Recent x-ray analysis of green fluorescent RNA suggests an alternative approach for the synthesis of RNA concatamers. In this approach, an RNA aptamer module is composed of two RNA strands. According to Zhu et al (2013), these RNA aptamer modules could self-assemble into "nanotrains" in a way that is similar to constructing long DNA strands from DNA segments equipped with "sticky" ends. We have already successfully tested the feasibility of synthesizing GFR modules composed of two RNA strands and demonstrated that upon binding DFHBI they emit bright green fluorescence. Testing of aptamers that can specifically target Salmonella enterica. Aptamers are DNA or RNA molecules that can bind to their targets with high affinity and specificity. They are commonly obtained in vitro using a combinatorial chemistry technique, which is known as systematic evolution of ligands by exponential enrichment (SELEX), from large DNA or RNA libraries that contains up to 10^18 different randomized sequences. Most attempts to identify Salmonella specific aptamer have been carried out using cell-SELEX, an approach in which aptamer selection involved live Salmonella cells. These experiments produced at least two dozen of DNA aptamers and a few RNA aptamers. An important structural feature of RNA that distinguishes it from DNA is the presence of a hydroxyl group at the 2' position of the ribose sugar. The 2' hydroxyl groups play many important roles. First, they increase stability of RNA aptamers by locking their double-stranded segments into an A-form helix. Second, 2'-hydroxyl groups present in the single-stranded regions are essential for binding RNA aptamers to their targets. Third, 2'-hydroxyl groups provide RNA with greater flexibility to form complex three-dimensional structures. The ability to form complex three-dimensional structures is essential for RNA aptamers' binding to their target with high specificity and affinity. Unlike DNA aptamers, RNA aptamers need to be modified to protect them from degradation by ubiquitous RNases. The modification process is expensive. For this reason, most Salmonella specific aptamers are DNA aptamers. To speed up the development of our detection assays, we tested the utility of DNA and RNA aptamers identified by other groups. Each aptamer was modified at its 5' end with biotin and attached to streptavidin derivatized with at least two GFR aptamers. We have already demonstrated that this strategy allows for the detection of coat proteins extracted from MS2 phages. However, all experiments involving either DNA or RNA aptamers developed by other groups were unsuccessful The 87 nucleotide-long DNA aptamer developed by Duan et al. (2013) has the following sequence: 5'- ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT-3'. According to mFOLD, a web server for nucleic acid folding prediction, this aptamer adopts many alternative secondary structures. When attached to streptavidin, this aptamer failed to bind to all Salmonella enterica serovars available to us. We speculate that when attached to streptavidin, the long DNA strand is unable to adopt the conformation required for binding to Salmonella cells. A shorter DNA aptamer developed by Joshi et al. (2009) has the following sequence: 5'-ATGTCCAGAATGCTATGGCGGCGTCACCCGACGGGGACTTGACATTATGACA-3'. It specifically recognizes Salmonella Typhimurium outer membrane proteins (OMPs). In our hands, the free aptamer recognized Salmonella enterica serovar Typhimurium Fresno but none of the other serovars available to us. However, when attached to streptavidin, the aptamer was unable to recognize cultured Salmonella Fresno. A free RNA aptamer having the sequence 5'-GGGUUCACUGCACACUUGACGAAGCUUGAGAGAUGCCCCCUGAUGUGCAUUCUUGU-UGUGU-3' recognized Salmonella enterica serovar Typhimurium Heidelberg (Ji-Yeon Hyeon et al., 2012). In the presence of this bacterium, the aptamer was readily degraded. Incorporation of fluoro-derivatives of CMP and UMP, which inhibits RNase A-type degradation, did not protect the aptamer from degradation by RNases secreted by the bacterium. Our analysis revealed that RNases secreted by Salmonella enterica serovar Typhimurium Heidelberg cells are G-specific. Replacing all G residues with their modified derivatives inhibited aptamer binding to Salmonella cells. We were unable to identify in the pool of RNA sequences randomly modified with Gx any aptamer derivative that could bind to Salmonella cells. These experiments suggest that the RNA aptamer developed by Ji-Yeon Hyeon contains a G-residue that cannot be modified without affecting its binding to Salmonella cells. Isolation of lipopolysaccharide from Salmonella enterica cells. Endotoxins, also known as lipopolysaccharides (LPS) are an integral component of Salmonella membranes. Harnessing LPS affinity of RNA molecules provides a promising approach for the detection of Salmonella enterica serovars. Using the Davis-Goldberg method, we extracted LPS molecules from several serovars of Salmonella enterica provided by The Salmonella Genetic Stock Center (Calgary, Canada). We are in the process of removing of lipid A from the Salmonella LPS preparations to produce core polysaccharide preparations that are suitable for producing RNA aptamers that specifically recognize multiple serovars of Salmonella enterica.
Publications
- Type:
Journal Articles
Status:
Published
Year Published:
2016
Citation:
Petrov, A.; Kay, S.; Kalvari, I.; Howe, K.; Gray, K.; Bruford, E.; Kersey, P.; Cochrane, G.; Finn, R.; Bateman, A.; Kozomara, A.; Griffiths-Jones, S.; Frankish, A.; Zwieb, C.; Lau, B.; Williams, K.; Chan, P. ; Lowe, T.; Cannone, J.; Gutell, R.; Machnicka, M.; Bujnicki, J.; Yoshihama, M.; Kenmochi, N.; Chai, B.; Cole, J. R.; Szymanski, M.; Karlowski, W.; Wood, V.; Berardini, T.; Huala, E.; Zhao, Y.; Chen, R.; Zhu, W.; Paraskevopoulou, M.; Vlachos, I.; Hatzigeorgiou, A.; Ma, L..; Zhang, Z.; Puetz, J.; Stadler, P.; McDonald, D.; Basu, S.; Fey, P.; Engel, S.; Cherry, J. M.; Volders, P.-J.; Mestdagh, P.; Wower, J.; Clark, M.; Quek, X. C.; Dinger, M. The RNAcentral Consortium. RNAcentral: a comprehensive database of non-coding RNA sequences.
Nucleic Acids Res. 2017 Jan 4;45(D1):D128-D134. Published online 28 October 2016
|